ID: 1048026430

View in Genome Browser
Species Human (GRCh38)
Location 8:130591484-130591506
Sequence CTACATGCATGGTCTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048026430_1048026433 24 Left 1048026430 8:130591484-130591506 CCTGGCACAGACCATGCATGTAG No data
Right 1048026433 8:130591531-130591553 CTGAGTGCATTGTAGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048026430 Original CRISPR CTACATGCATGGTCTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr