ID: 1048026996

View in Genome Browser
Species Human (GRCh38)
Location 8:130596264-130596286
Sequence ATGGCAGAGGGCCCCCGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048026996_1048027003 26 Left 1048026996 8:130596264-130596286 CCATTGCGGGGGCCCTCTGCCAT 0: 1
1: 0
2: 2
3: 10
4: 89
Right 1048027003 8:130596313-130596335 GCCCTTCTGCCAGCAGCTCTTGG 0: 1
1: 0
2: 5
3: 40
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048026996 Original CRISPR ATGGCAGAGGGCCCCCGCAA TGG (reversed) Intergenic
900413792 1:2525978-2526000 TTGGCAGAGTGGCCCCGAAAAGG - Intronic
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
909484520 1:76158392-76158414 ATGTCAGAGGGCCCCGGCTCTGG - Intronic
918521504 1:185420117-185420139 ATGGAAGAGGTCCTCCACAATGG - Intergenic
919982332 1:202650088-202650110 TTGGCAGAGGGCCCCGGAAGAGG + Intronic
1064261787 10:13792107-13792129 CTGGCAGAGTGCCCCTGCACAGG - Intronic
1064909440 10:20384333-20384355 TTTGCAGAGAGCCCCCGCTAGGG + Intergenic
1067922434 10:50473737-50473759 ATGGCAGAGTCCCCCAGAAATGG - Intronic
1078618014 11:12882826-12882848 CTGGCAGAGGGCCCCAGTGATGG - Intronic
1083613541 11:64015562-64015584 GAGGCAGATGGCCCCCGCCACGG + Intronic
1083951236 11:65957625-65957647 CTGGCACAGGGCCACAGCAAGGG + Intronic
1091498132 12:990578-990600 ATCGCCGAGGACCCCAGCAATGG - Intronic
1094838362 12:34332743-34332765 ATGGCAGAGGTCCCCCACCATGG + Intergenic
1094844191 12:34354269-34354291 GTGGCAGAGGTCCCCCCCATGGG - Intergenic
1094844372 12:34354985-34355007 ATGGCAGAGGTCCCTCCCAATGG - Intergenic
1094847727 12:34368663-34368685 AAGGCAGAGGTCCCCCCCACTGG - Intergenic
1094848036 12:34369973-34369995 ATGGCAGAGGTCACCCCCATGGG - Intergenic
1094848519 12:34372040-34372062 GTGGCAGAGGTCCCCCGCCACGG - Intergenic
1094848562 12:34372227-34372249 ACGGCAGAGGGACCCCCCATGGG - Intergenic
1094848995 12:34373922-34373944 GAGGCAGAGGTCCCCCGCACGGG - Intergenic
1094850169 12:34378789-34378811 ATGGCAGAGGTCCCCCCCATGGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG + Intergenic
1094856442 12:34404992-34405014 GTGGCAGAGGTCCCCCACTATGG + Intergenic
1094870546 12:34597021-34597043 ATGGCTGAGGTCCCCCTCACAGG + Intergenic
1100455509 12:94747941-94747963 ATGGCAGAGGGCAAGAGCAAGGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1109859004 13:68172401-68172423 ATGGGAGAGGCCCACCTCAATGG - Intergenic
1118700400 14:68427186-68427208 ATGGCAGAGAGCCCCATCTAGGG + Intronic
1119413999 14:74457334-74457356 ATGGGAGAGGGCGCCTGCTAGGG - Intergenic
1119560990 14:75589625-75589647 ACTGCAGAGAGCCCCCACAAGGG - Intronic
1120342896 14:83244922-83244944 ATGGCAGGGGGCTGCCACAAAGG - Intergenic
1127626309 15:60783658-60783680 ATGGAAGAGGTCCTCTGCAAAGG - Intronic
1128617332 15:69120585-69120607 ATGGCAGAAGGGGCCCCCAAAGG + Intergenic
1132738508 16:1399119-1399141 CTGGCAGAGGGGCCCCGGTAGGG + Intronic
1134191079 16:12121657-12121679 AAGGCAGAGGGCCACCAAAAAGG - Intronic
1135498013 16:22969539-22969561 ATTGAATAGGGCCCCTGCAAGGG - Intergenic
1138708127 16:58938779-58938801 ATAGCAGTGGGCCCCAGAAATGG - Intergenic
1141949996 16:87334039-87334061 AGGGCAGAGGCGCCCAGCAAGGG - Exonic
1142848566 17:2693663-2693685 ATGGCAGGGGACCCCCCCACAGG - Intronic
1148817775 17:50342970-50342992 CTGGCAGAGGGTACACGCAAAGG + Intergenic
1151366061 17:73617214-73617236 AGGGGAGAGGGCTCCCGCAGAGG + Intronic
1151940404 17:77288276-77288298 AAAGCAGAGGGCCCCGGCCATGG - Intronic
1152528326 17:80902375-80902397 ATGGCAGAGGGGCCGGGCCAGGG - Intronic
1152827877 17:82478966-82478988 ATGGCACAGGGGCCCAGGAAGGG + Intronic
1155633367 18:27921967-27921989 ATGGGAGAGGACACCCGCAGGGG - Intergenic
1156459985 18:37316207-37316229 ATGGCAGCTGGCCCCCTCAGAGG - Intronic
1160497138 18:79382316-79382338 AGGGCAGAGGGCGCCTGCAATGG - Intergenic
1160764886 19:803155-803177 AGGGCAGAGGACCCCCTCCATGG - Intronic
1162565030 19:11441277-11441299 ATGGCCGAGGTCACCCGCGAAGG + Exonic
1162963957 19:14146840-14146862 AAGGCAGAGGGGCCCGGAAAAGG + Intergenic
1163817753 19:19477274-19477296 ATGGCACAGGTCCCAAGCAAGGG - Intronic
1164983730 19:32632885-32632907 ATGGCAGAGGACCCCAGGAATGG - Intronic
1166820645 19:45577396-45577418 ATGGCTGGGGGCCACAGCAAAGG + Intronic
1167602808 19:50464565-50464587 CTGGCACAGGGCCCGAGCAAGGG - Intronic
927933071 2:27058192-27058214 ATGGAAGAGGGCCCCCAAATTGG + Intronic
927973664 2:27322091-27322113 ATGGCATAGGGCCCCCACAAAGG - Intronic
930022903 2:47012181-47012203 ACGGCACTGGGCCCCAGCAATGG + Intronic
948548457 2:238749942-238749964 TTGGCAGATGTCCCCAGCAAAGG - Intergenic
948858503 2:240741722-240741744 ATGGCAGAGCGGCCCCGTGAGGG - Intronic
1169392113 20:5198732-5198754 TGGGCAGAGGGCCCACGCCAGGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171154734 20:22861598-22861620 ATTGCAGAGGGCATCCTCAATGG - Intergenic
1173145330 20:40519821-40519843 ATGGCAGAGGGCTCAGGAAATGG + Intergenic
1174671738 20:52314371-52314393 ATGGCAGAGTGGCCCCTCACAGG + Intergenic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1182555382 22:31126008-31126030 TTGGGAGAGGGCCCCCTCACCGG - Exonic
1184744492 22:46448290-46448312 GGGGCAGAGGGCCCACGCGAGGG + Intronic
953815722 3:46154618-46154640 ATGACAGATGGCCACCACAAAGG + Intergenic
955069073 3:55557228-55557250 GTGGCAGATGGCCCCCCCAGTGG + Intronic
968137414 3:196229005-196229027 TTGACAGAGGGCCCCAGAAAAGG + Intronic
970187978 4:13483535-13483557 ATTGAAAAGGGCCGCCGCAAAGG - Intronic
982872837 4:160606035-160606057 ATTGCAGAGGCCACCCTCAAGGG - Intergenic
984790331 4:183609296-183609318 ATGGCAACGGGCCCCAGAAAAGG - Intergenic
988320326 5:29686439-29686461 ACTGCAGAGAGCCCCCACAAGGG - Intergenic
988454160 5:31372840-31372862 ATGGCAGAGGGCTCCAGGAAGGG - Intergenic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
997371547 5:133364401-133364423 GTGGCAGCAGGCCACCGCAAAGG + Intronic
1007599539 6:43073224-43073246 ATGGCAGTGGGACCCTGCAGAGG + Exonic
1008879303 6:56364487-56364509 ATGGGAGAGGGTCTCCCCAAAGG - Intronic
1009395038 6:63189845-63189867 ATGTGAGAGGGCCCCCACGATGG - Intergenic
1017503670 6:155047922-155047944 ATGTCAGTGGGCCTCAGCAAGGG + Intronic
1018736108 6:166688320-166688342 ACTGCACAGGGCCCCCGCCAGGG + Intronic
1019544187 7:1565262-1565284 GGGGCAGCGGGCCCCTGCAAGGG + Intergenic
1019896991 7:3990322-3990344 GTTGCAGAGGCCCCCCGCAGGGG - Intronic
1022204926 7:28154317-28154339 ATGGCAGAGGGCCACTGTCAGGG + Intronic
1022675594 7:32495848-32495870 AGGGCAGGGGGGCCCCGGAAGGG - Intronic
1022844092 7:34192486-34192508 ATAGCAGAGGGCCCATGCATTGG + Intergenic
1023715454 7:43039407-43039429 ATGGGAAAGGGCCCCTGCACTGG - Intergenic
1025611261 7:63077359-63077381 AGGGCTGAGGGCCACAGCAATGG - Intergenic
1027267693 7:76503332-76503354 ATGGTAAAGGGCCCCGGGAATGG - Intronic
1027319505 7:77003195-77003217 ATGGTAAAGGGCCCCGGGAATGG - Intergenic
1035616135 8:1003159-1003181 ATGGCGCAGGGCCACCGCTATGG + Intergenic
1040285908 8:46100256-46100278 CTCGCAGAAGGCCCCCACAAAGG - Intergenic
1040811784 8:51461566-51461588 ATGGCAGAGGACCCCAGGCATGG - Intronic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1051344870 9:16142875-16142897 ATGGCCGTGGGCACCTGCAAAGG - Intergenic
1053406353 9:37879801-37879823 AGGGCAGAGGGCACCTGCATGGG + Intronic
1062515662 9:136933961-136933983 ATGGCAGAGAGCCCACACTAGGG + Intronic
1199746508 X:150775181-150775203 AGGGCGGAGGGCCACAGCAAGGG + Intronic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic