ID: 1048030167

View in Genome Browser
Species Human (GRCh38)
Location 8:130623607-130623629
Sequence GTCCATTTTAGGTCTGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048030164_1048030167 9 Left 1048030164 8:130623575-130623597 CCAAAGAAATATGAATGTATGTT No data
Right 1048030167 8:130623607-130623629 GTCCATTTTAGGTCTGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048030167 Original CRISPR GTCCATTTTAGGTCTGGCTA TGG Intergenic
No off target data available for this crispr