ID: 1048030372

View in Genome Browser
Species Human (GRCh38)
Location 8:130626025-130626047
Sequence TTTTAGATAAATATTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048030372_1048030377 10 Left 1048030372 8:130626025-130626047 CCTCCCAAAATATTTATCTAAAA No data
Right 1048030377 8:130626058-130626080 AATGGCCATCTTTTACCCTCAGG No data
1048030372_1048030375 -8 Left 1048030372 8:130626025-130626047 CCTCCCAAAATATTTATCTAAAA No data
Right 1048030375 8:130626040-130626062 ATCTAAAATAAGTCCTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048030372 Original CRISPR TTTTAGATAAATATTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr