ID: 1048033901

View in Genome Browser
Species Human (GRCh38)
Location 8:130658624-130658646
Sequence CTGAATAATAGGAGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048033896_1048033901 17 Left 1048033896 8:130658584-130658606 CCAGGGAAGGGATCTGGGAAGAG No data
Right 1048033901 8:130658624-130658646 CTGAATAATAGGAGGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048033901 Original CRISPR CTGAATAATAGGAGGGAGTC AGG Intergenic
No off target data available for this crispr