ID: 1048034802

View in Genome Browser
Species Human (GRCh38)
Location 8:130667445-130667467
Sequence GAAGACCCCCGGTCATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048034802_1048034807 11 Left 1048034802 8:130667445-130667467 CCCTGGGATGACCGGGGGTCTTC No data
Right 1048034807 8:130667479-130667501 CCCCAAACTTCCCATCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048034802 Original CRISPR GAAGACCCCCGGTCATCCCA GGG (reversed) Intergenic
No off target data available for this crispr