ID: 1048035323

View in Genome Browser
Species Human (GRCh38)
Location 8:130672483-130672505
Sequence GGCTAACAAATCCAGTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048035323_1048035328 8 Left 1048035323 8:130672483-130672505 CCGAGGAACTGGATTTGTTAGCC No data
Right 1048035328 8:130672514-130672536 CGGCCTCTCAGCTCCCTTGAGGG No data
1048035323_1048035330 12 Left 1048035323 8:130672483-130672505 CCGAGGAACTGGATTTGTTAGCC No data
Right 1048035330 8:130672518-130672540 CTCTCAGCTCCCTTGAGGGTAGG No data
1048035323_1048035333 22 Left 1048035323 8:130672483-130672505 CCGAGGAACTGGATTTGTTAGCC No data
Right 1048035333 8:130672528-130672550 CCTTGAGGGTAGGCTTGCATAGG No data
1048035323_1048035327 7 Left 1048035323 8:130672483-130672505 CCGAGGAACTGGATTTGTTAGCC No data
Right 1048035327 8:130672513-130672535 TCGGCCTCTCAGCTCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048035323 Original CRISPR GGCTAACAAATCCAGTTCCT CGG (reversed) Intergenic
No off target data available for this crispr