ID: 1048035326

View in Genome Browser
Species Human (GRCh38)
Location 8:130672511-130672533
Sequence TCAAGGGAGCTGAGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048035326_1048035335 17 Left 1048035326 8:130672511-130672533 CCTCGGCCTCTCAGCTCCCTTGA No data
Right 1048035335 8:130672551-130672573 CCTGCCCACCACAGAACAGTCGG No data
1048035326_1048035333 -6 Left 1048035326 8:130672511-130672533 CCTCGGCCTCTCAGCTCCCTTGA No data
Right 1048035333 8:130672528-130672550 CCTTGAGGGTAGGCTTGCATAGG No data
1048035326_1048035338 24 Left 1048035326 8:130672511-130672533 CCTCGGCCTCTCAGCTCCCTTGA No data
Right 1048035338 8:130672558-130672580 ACCACAGAACAGTCGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048035326 Original CRISPR TCAAGGGAGCTGAGAGGCCG AGG (reversed) Intergenic
No off target data available for this crispr