ID: 1048035333

View in Genome Browser
Species Human (GRCh38)
Location 8:130672528-130672550
Sequence CCTTGAGGGTAGGCTTGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048035323_1048035333 22 Left 1048035323 8:130672483-130672505 CCGAGGAACTGGATTTGTTAGCC No data
Right 1048035333 8:130672528-130672550 CCTTGAGGGTAGGCTTGCATAGG No data
1048035325_1048035333 1 Left 1048035325 8:130672504-130672526 CCTCTTTCCTCGGCCTCTCAGCT No data
Right 1048035333 8:130672528-130672550 CCTTGAGGGTAGGCTTGCATAGG No data
1048035326_1048035333 -6 Left 1048035326 8:130672511-130672533 CCTCGGCCTCTCAGCTCCCTTGA No data
Right 1048035333 8:130672528-130672550 CCTTGAGGGTAGGCTTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048035333 Original CRISPR CCTTGAGGGTAGGCTTGCAT AGG Intergenic
No off target data available for this crispr