ID: 1048035335

View in Genome Browser
Species Human (GRCh38)
Location 8:130672551-130672573
Sequence CCTGCCCACCACAGAACAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048035329_1048035335 11 Left 1048035329 8:130672517-130672539 CCTCTCAGCTCCCTTGAGGGTAG No data
Right 1048035335 8:130672551-130672573 CCTGCCCACCACAGAACAGTCGG No data
1048035325_1048035335 24 Left 1048035325 8:130672504-130672526 CCTCTTTCCTCGGCCTCTCAGCT No data
Right 1048035335 8:130672551-130672573 CCTGCCCACCACAGAACAGTCGG No data
1048035326_1048035335 17 Left 1048035326 8:130672511-130672533 CCTCGGCCTCTCAGCTCCCTTGA No data
Right 1048035335 8:130672551-130672573 CCTGCCCACCACAGAACAGTCGG No data
1048035331_1048035335 1 Left 1048035331 8:130672527-130672549 CCCTTGAGGGTAGGCTTGCATAG No data
Right 1048035335 8:130672551-130672573 CCTGCCCACCACAGAACAGTCGG No data
1048035332_1048035335 0 Left 1048035332 8:130672528-130672550 CCTTGAGGGTAGGCTTGCATAGG No data
Right 1048035335 8:130672551-130672573 CCTGCCCACCACAGAACAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048035335 Original CRISPR CCTGCCCACCACAGAACAGT CGG Intergenic
No off target data available for this crispr