ID: 1048035425

View in Genome Browser
Species Human (GRCh38)
Location 8:130673112-130673134
Sequence AGCAATCCACAGGGGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048035416_1048035425 3 Left 1048035416 8:130673086-130673108 CCTCCACCCTTCCTGACTCTGAA No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035418_1048035425 -3 Left 1048035418 8:130673092-130673114 CCCTTCCTGACTCTGAAAGCAGC No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035413_1048035425 27 Left 1048035413 8:130673062-130673084 CCAGAGTCCTCCTAAGGGAAGCT No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035412_1048035425 28 Left 1048035412 8:130673061-130673083 CCCAGAGTCCTCCTAAGGGAAGC No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035415_1048035425 17 Left 1048035415 8:130673072-130673094 CCTAAGGGAAGCTGCCTCCACCC No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035417_1048035425 0 Left 1048035417 8:130673089-130673111 CCACCCTTCCTGACTCTGAAAGC No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035414_1048035425 20 Left 1048035414 8:130673069-130673091 CCTCCTAAGGGAAGCTGCCTCCA No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035419_1048035425 -4 Left 1048035419 8:130673093-130673115 CCTTCCTGACTCTGAAAGCAGCA No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data
1048035420_1048035425 -8 Left 1048035420 8:130673097-130673119 CCTGACTCTGAAAGCAGCAATCC No data
Right 1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048035425 Original CRISPR AGCAATCCACAGGGGTTGGA AGG Intergenic
No off target data available for this crispr