ID: 1048035648

View in Genome Browser
Species Human (GRCh38)
Location 8:130674800-130674822
Sequence GATGCTGGTAGGACACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048035648_1048035653 -7 Left 1048035648 8:130674800-130674822 CCTTCCTGTGTCCTACCAGCATC No data
Right 1048035653 8:130674816-130674838 CAGCATCCACTCACCACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048035648 Original CRISPR GATGCTGGTAGGACACAGGA AGG (reversed) Intergenic
No off target data available for this crispr