ID: 1048039141

View in Genome Browser
Species Human (GRCh38)
Location 8:130708126-130708148
Sequence TAGTGACTTCTCGTGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048039141_1048039143 -3 Left 1048039141 8:130708126-130708148 CCAGATCTCACGAGAAGTCACTA No data
Right 1048039143 8:130708146-130708168 CTATTATGAGAACAGCAAGTGGG No data
1048039141_1048039142 -4 Left 1048039141 8:130708126-130708148 CCAGATCTCACGAGAAGTCACTA No data
Right 1048039142 8:130708145-130708167 ACTATTATGAGAACAGCAAGTGG 0: 36
1: 569
2: 2558
3: 4334
4: 5383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048039141 Original CRISPR TAGTGACTTCTCGTGAGATC TGG (reversed) Intergenic
No off target data available for this crispr