ID: 1048039210

View in Genome Browser
Species Human (GRCh38)
Location 8:130709173-130709195
Sequence ATGGAGAATTAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048039199_1048039210 25 Left 1048039199 8:130709125-130709147 CCACATGAAATTCATGACAGTGA No data
Right 1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG No data
1048039198_1048039210 26 Left 1048039198 8:130709124-130709146 CCCACATGAAATTCATGACAGTG No data
Right 1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG No data
1048039206_1048039210 0 Left 1048039206 8:130709150-130709172 CCTCTCGGGGAGGGAGATGGAGA No data
Right 1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048039210 Original CRISPR ATGGAGAATTAGAATGAGGA GGG Intergenic
No off target data available for this crispr