ID: 1048048052

View in Genome Browser
Species Human (GRCh38)
Location 8:130791773-130791795
Sequence CTGTAAACACCTGTGGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048048052_1048048057 -2 Left 1048048052 8:130791773-130791795 CCGAGCCCCACAGGTGTTTACAG 0: 1
1: 0
2: 4
3: 16
4: 182
Right 1048048057 8:130791794-130791816 AGGTCCATCCCTTGTCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048048052 Original CRISPR CTGTAAACACCTGTGGGGCT CGG (reversed) Intronic
901622417 1:10599311-10599333 CAGGAACCACCTGTGTGGCTGGG - Exonic
901862327 1:12082222-12082244 CTTGAAACACATGGGGGGCTTGG + Intronic
902218282 1:14948544-14948566 CTGTCAACACCTGTGGTTCAGGG - Intronic
902407966 1:16196634-16196656 ATGTGAACACCTGTGGGGCTGGG - Intergenic
902724905 1:18328877-18328899 CTGTAAACTCGTGTGGGGCGTGG + Intronic
905389916 1:37629730-37629752 TTGCTAACACCTCTGGGGCTGGG + Exonic
905775336 1:40664506-40664528 CTGATAACACCCCTGGGGCTAGG + Intronic
906294601 1:44641758-44641780 TTCTGAACACCTGTGGGGGTAGG + Intronic
907239749 1:53074882-53074904 CTCTACACTCCTGTGGGCCTTGG - Intronic
907561958 1:55399336-55399358 CTGCAAGCACCTGCGTGGCTGGG + Intergenic
908585669 1:65564740-65564762 CGGTAATCAGCTGTGGGACTTGG - Intronic
912685641 1:111760836-111760858 CTGTACACACCTATGAGACTTGG - Exonic
916788285 1:168102413-168102435 CTGTAAACCCCTGGTGGGCAGGG + Intronic
919438235 1:197591250-197591272 CTATAAGCTCCTGTGGGGATGGG + Intronic
920976562 1:210791327-210791349 GTGGAATCACCTCTGGGGCTAGG + Intronic
923243558 1:232109409-232109431 CTGTAAGCACTTGAAGGGCTAGG + Intergenic
924704843 1:246492338-246492360 CTGGAATCACCTGGGGAGCTTGG - Intronic
1063032034 10:2245059-2245081 ATTTAAACACAAGTGGGGCTGGG - Intergenic
1064128688 10:12688256-12688278 ATGGTTACACCTGTGGGGCTGGG + Intronic
1067015837 10:42755718-42755740 ATCTCAACACCTGTGGGGGTGGG - Intergenic
1067457286 10:46428021-46428043 CTGGGAACACCAGTGGGGATGGG + Intergenic
1067672850 10:48341228-48341250 ATCTAAACAGCTGTGGGTCTGGG + Intronic
1070122822 10:73595214-73595236 AAGAAAACACCAGTGGGGCTTGG - Intronic
1072449685 10:95530055-95530077 CTGTGAACACCTGCAGGGCAGGG + Intronic
1073349290 10:102808477-102808499 AAGTAAAGAGCTGTGGGGCTTGG + Intronic
1077084032 11:738835-738857 ATGAAAACCTCTGTGGGGCTGGG + Intergenic
1077355840 11:2116516-2116538 GTGTCAACAACTGAGGGGCTGGG + Intergenic
1078098211 11:8313354-8313376 CTGGGGACACCTGTGGGCCTTGG - Intergenic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1080675472 11:34422562-34422584 CTGTAAACAACTGTGGGAATTGG + Intergenic
1080855838 11:36110932-36110954 CTGAAAACAAACGTGGGGCTGGG + Intronic
1083158535 11:60840651-60840673 CTGGCAACACCTGCCGGGCTTGG + Intergenic
1083241065 11:61389169-61389191 CAGTAAAAACCTTGGGGGCTGGG - Intergenic
1084008989 11:66337399-66337421 CTGAGAACACCTGGGGGGCCTGG + Exonic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1086319171 11:85627537-85627559 CTGAAAACACCTTTGGGGGAAGG - Intronic
1087268004 11:96082263-96082285 CTGTGAACTCCTGGAGGGCTGGG - Intronic
1088583412 11:111336452-111336474 CTTTGCACACCTGTGTGGCTGGG + Intergenic
1090033757 11:123230409-123230431 CTTTAATCACCTGTGAAGCTTGG + Intergenic
1091335809 11:134764844-134764866 CTGTGAAGACCTGAGGGGCTTGG + Intergenic
1092013880 12:5140236-5140258 GTGTAAACACTTTTGGGGGTGGG + Intergenic
1093192914 12:16095513-16095535 ATGAAAACACCTGTGGGATTTGG + Intergenic
1096492128 12:52018737-52018759 CTGAAAATCCCTTTGGGGCTGGG + Intergenic
1100045153 12:90371060-90371082 ATGTAAACACCTATGTGTCTTGG - Intergenic
1100357448 12:93844748-93844770 CTGCAAGAGCCTGTGGGGCTGGG - Intronic
1100689769 12:97027567-97027589 CTGTAAGCACCTGGAGGGCAAGG + Intergenic
1102751090 12:115295298-115295320 CTCTAACCAACTGTGGGACTGGG + Intergenic
1104921333 12:132292259-132292281 CTGTGAACACATGAGGCGCTGGG - Intronic
1105453868 13:20523592-20523614 TTGGAATCACCTGTGGGGCCAGG + Intronic
1112091587 13:96090020-96090042 CTGGAAACTCCTCCGGGGCTGGG + Intergenic
1115002472 14:28439502-28439524 CTGTAAACCCCAGAGGGGCAAGG + Intergenic
1115126904 14:30006774-30006796 CTGTAAACACCTGTAAGTATGGG + Intronic
1116547304 14:46184786-46184808 GTGTGAACACCTTTGAGGCTGGG - Intergenic
1117545068 14:56786804-56786826 CTGAGAACACATGTGGGTCTTGG - Intergenic
1117782703 14:59251003-59251025 TTGGAATCACCTATGGGGCTTGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119848091 14:77845964-77845986 CTGTAACTACCTGTGGCTCTGGG + Intronic
1121028607 14:90637411-90637433 CTGTAAAACCATGTGGGGCTGGG - Intronic
1122702397 14:103598642-103598664 CAGTAAGCACCTGGGGGGCTTGG + Intronic
1125318782 15:38459645-38459667 ATGTAAACAGCTGTGGGAGTCGG - Intronic
1126773344 15:52078721-52078743 GTGCAAAGACCTGTGGGGCAAGG - Intergenic
1128618346 15:69127958-69127980 CTGTAAACTCCACTGGGGCAGGG + Intergenic
1129222605 15:74140425-74140447 CTGTTAACAAATGTGGGGCAGGG - Intergenic
1132294653 15:100726332-100726354 CTGAAAACACCCATGGGGCCTGG - Intergenic
1132942619 16:2515424-2515446 CTGTAAACACCTGTGGGGTGGGG + Intronic
1133973995 16:10587288-10587310 CTGTAAAGATTAGTGGGGCTGGG - Intergenic
1134748540 16:16607065-16607087 CTGTAAACTCCAGAGGGGCAAGG - Intergenic
1134996925 16:18746551-18746573 CTGTAAACTCCAGAGGGGCAAGG + Intergenic
1136635545 16:31520214-31520236 CTGTTATCACCTGTGGGCTTGGG - Intergenic
1136847689 16:33589733-33589755 CTTTAAATACTTGGGGGGCTGGG + Intergenic
1137953205 16:52803161-52803183 CTGTGATCACCTTTGGGGTTTGG - Intergenic
1139376156 16:66498012-66498034 CTGTAAAGACCACTGAGGCTAGG + Intronic
1140750434 16:78018615-78018637 CTGTAAACTCCTGCAGGGCAGGG - Intergenic
1203109397 16_KI270728v1_random:1438382-1438404 CTTTAAATACTTGGGGGGCTGGG + Intergenic
1143768210 17:9151226-9151248 TTCTTCACACCTGTGGGGCTTGG - Intronic
1145027251 17:19477172-19477194 CTGTAAAGCCCTCTGGGACTAGG + Intergenic
1148385262 17:47229791-47229813 CTGTAATCACCTGAGGGCCACGG + Intergenic
1149370586 17:55990417-55990439 CTGTGAACACCTGGAGGGCTGGG - Intergenic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1150331283 17:64296517-64296539 TTGAGGACACCTGTGGGGCTAGG - Intergenic
1151547720 17:74803434-74803456 CTGTGCACAGGTGTGGGGCTCGG - Intronic
1151985404 17:77540201-77540223 CTTTAAACACCTTTGAGGCTGGG - Intergenic
1157016620 18:43722584-43722606 CTGTAAACAAATGTGGTCCTGGG - Intergenic
1157696633 18:49728544-49728566 CCTTAAACTCCTGTGGGGCAGGG + Intergenic
1158243025 18:55398812-55398834 CTGTAAACTCCTGGAGGGCAGGG - Intronic
1161627114 19:5333768-5333790 ATCTAAGCAGCTGTGGGGCTTGG - Intronic
1162322402 19:9977843-9977865 CTGTGAGCACCTGAGGGGCAGGG + Intronic
1163264117 19:16208006-16208028 CGGAAAACACCTGTGGCGGTTGG - Exonic
1163833213 19:19557673-19557695 CTGTAATCACCTTTATGGCTTGG + Intergenic
1165027766 19:32974119-32974141 CAGTAAACTTCTGTAGGGCTGGG - Exonic
1168400605 19:56084207-56084229 CTGTATACCCGGGTGGGGCTGGG - Intergenic
925123310 2:1436598-1436620 CTGTAAGCACCTATGTGGATGGG - Intronic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
928027592 2:27752793-27752815 CTGTAGGCGCCTGTGGGGGTGGG - Intergenic
928948196 2:36790977-36790999 CTGTTAGCACCTGTGGGTCCGGG - Intronic
929145723 2:38705776-38705798 CTGTACCCAACTGTAGGGCTGGG - Intronic
929811950 2:45197024-45197046 CTGTAAACATCAGTTAGGCTAGG - Intergenic
930680887 2:54255747-54255769 CTCTAGAAACCTGTGGGGCAGGG - Exonic
930943176 2:57038344-57038366 CTGTAAATACTTGGGTGGCTTGG + Intergenic
932823680 2:74921811-74921833 GTGTAAAAACATGTGGGGCCAGG + Intergenic
932826322 2:74944282-74944304 CTGTAAACACATGTATGGCATGG + Intergenic
933568406 2:83978434-83978456 TTGTAAACACCATTGAGGCTAGG + Intergenic
934864310 2:97792419-97792441 CTGTAAACACTTCTAGGGCTGGG + Exonic
935140503 2:100349177-100349199 CTGAAAACAACTCTGGGGGTTGG - Intergenic
938298615 2:130194304-130194326 CTGTGGAGACCTGGGGGGCTGGG + Exonic
938458116 2:131480209-131480231 CTGTGGAGACCTGGGGGGCTGGG - Exonic
938780217 2:134577727-134577749 CTGTAAATACCTGGTGGGCACGG - Intronic
940848650 2:158667452-158667474 CTGTCACCAGCTGTGGGACTTGG - Intronic
941623779 2:167808390-167808412 CTGTAAAGACCATTGAGGCTAGG - Intergenic
945481713 2:210352658-210352680 TTGTAAAGACCAGTGAGGCTAGG + Intergenic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
946579703 2:221115070-221115092 CTGTAATCAGCTGGGGGACTTGG - Intergenic
1170831227 20:19842535-19842557 CTGTAAACAGATGTGTGGCTGGG - Intergenic
1170963364 20:21044802-21044824 CTCTAAACTTCTGAGGGGCTGGG + Intergenic
1172011331 20:31847734-31847756 TTGCAAAGACCAGTGGGGCTTGG + Intronic
1172420117 20:34808856-34808878 TTGAAATCACCTGTGGAGCTTGG - Intronic
1176703430 21:10088103-10088125 CTGTAACAACCTATGGTGCTTGG + Intergenic
1177629231 21:23704796-23704818 ATGTAAAGACCTGTGAAGCTTGG - Intergenic
1178697060 21:34802373-34802395 CTGTAAGTGCCTGTGGGGCAGGG - Intronic
1180674996 22:17580913-17580935 CTCTGGACACCTGTGGGGCTGGG + Intronic
1180751325 22:18126494-18126516 CAGTAGAGACCTGGGGGGCTGGG - Exonic
1182079270 22:27517786-27517808 CTGTAAACACCCATGGGGAAAGG - Intergenic
1184554650 22:45226544-45226566 CTGGAAACAGCTGTGGGGTCGGG - Intronic
954885623 3:53870740-53870762 CTGTGAAGACCTGTGTGGCTGGG - Intronic
956038614 3:65121924-65121946 TTGTAAAGACCAATGGGGCTAGG + Intergenic
957804054 3:85123947-85123969 CTGGAAACAAATGTTGGGCTGGG + Intronic
959384922 3:105692045-105692067 CTGTAAATTTCTGGGGGGCTGGG + Intronic
960433717 3:117600448-117600470 GTGTGAACACCTGTTGGGCTGGG - Intergenic
961283010 3:125778227-125778249 CAGTCAGCACCTGTGGGGCAGGG + Intergenic
961564986 3:127757002-127757024 CTGTAAATAAATGTTGGGCTTGG + Intronic
961914095 3:130352151-130352173 CTGTCAGCAGGTGTGGGGCTGGG + Intronic
963110546 3:141684316-141684338 CTTTTAAAACCTGTGGGGCCGGG - Intergenic
965566553 3:170124660-170124682 TTGTTAACATTTGTGGGGCTAGG - Intronic
969461440 4:7331217-7331239 CTGGAGACTGCTGTGGGGCTCGG + Intronic
969851474 4:9960468-9960490 CTGTAAACCCTTAAGGGGCTGGG - Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
971343649 4:25792772-25792794 CACTAACCACCTGTGGGCCTTGG - Intronic
976702012 4:87980114-87980136 TTAAAAATACCTGTGGGGCTAGG - Exonic
977343876 4:95793412-95793434 CTGTAAAGACCATTGAGGCTAGG + Intergenic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
979526704 4:121725133-121725155 CTAAAAACACCTGCAGGGCTGGG - Intergenic
980375649 4:131944453-131944475 CTGTAATAACCTATGGTGCTTGG + Intergenic
982739960 4:159046866-159046888 CTATAAACAGCTGAAGGGCTGGG - Intergenic
983108771 4:163723112-163723134 CTGTAAAGACCACTGAGGCTAGG - Intronic
985794448 5:1951999-1952021 CTGTCAGCACCTGTGCGGCGGGG + Intergenic
986279676 5:6313212-6313234 CTGTGAACATCAGTGGGCCTTGG - Intergenic
986300727 5:6476529-6476551 ACGGAAACACCTGGGGGGCTCGG + Intronic
989509559 5:42269165-42269187 CTTTAAACACCAATGAGGCTGGG + Intergenic
990241310 5:53819270-53819292 CTGTCAACTGCTTTGGGGCTTGG - Intergenic
993777218 5:92014172-92014194 CTGTTTAGACCTGTGGGGTTTGG - Intergenic
995692848 5:114846443-114846465 CTGTAAAGACCATTGAGGCTAGG + Intergenic
997142858 5:131401260-131401282 ATGTAAACAACTGTCGGGCTGGG + Intergenic
997361990 5:133301030-133301052 CTGAAAACACCTGTGGCACACGG + Intronic
997856708 5:137379148-137379170 CTGTAAACTACTGTGGGCCAAGG + Intronic
998631758 5:143906363-143906385 CTCTAACCAGCTGTGGGACTTGG + Intergenic
999428442 5:151506378-151506400 CTGTATCCAGCTGTGGGGGTGGG - Intronic
1000348304 5:160332654-160332676 CTGTACAGATATGTGGGGCTGGG - Intronic
1003572793 6:7267053-7267075 CTGCCATCACCCGTGGGGCTTGG - Intergenic
1005101680 6:22178945-22178967 CTGTAAACACCATCGAGGCTAGG - Intergenic
1006605697 6:35255340-35255362 GTGTAAAAACCTGAGGAGCTTGG + Intergenic
1006730233 6:36230862-36230884 GTAGAAACAGCTGTGGGGCTTGG + Exonic
1008764991 6:54901256-54901278 CTGTAAACTCCAGTGGGACAGGG + Intronic
1015070891 6:129091551-129091573 CAGTACACACTTGTGGGGGTAGG + Intronic
1016172706 6:141040154-141040176 GTCTAAACACCTGTGGGGTGGGG - Intergenic
1019129029 6:169860080-169860102 CTGTCATCATCTGTGGGGCTGGG + Intergenic
1020865157 7:13551082-13551104 CTGGAAGCACATGTGGGCCTTGG - Intergenic
1022955029 7:35372868-35372890 CTGTAGGGACCTGTGGGGATAGG - Intergenic
1023956639 7:44891893-44891915 CTGCAAAGACCTGTGAGGCCTGG + Intergenic
1024346432 7:48319178-48319200 CAGAACACACATGTGGGGCTTGG - Intronic
1024384745 7:48738681-48738703 ATGTAAACACCCCTGAGGCTTGG - Intergenic
1025553442 7:62275898-62275920 CGGTAAAAACCTGTGGCGGTGGG + Intergenic
1025869412 7:65416786-65416808 CTGTAAAGACCATTGAGGCTAGG + Intergenic
1027943455 7:84715103-84715125 ATGTGAACACCTGTGAGGCTGGG - Intergenic
1028500016 7:91508758-91508780 CTGTAAAGACCATTGAGGCTAGG + Intergenic
1034637347 7:152577668-152577690 ATGGAAACACCTGTTGGGCAGGG + Intergenic
1035925793 8:3726227-3726249 CTGTAAACCCATGAGAGGCTGGG + Intronic
1038791480 8:30672037-30672059 CTGTAATCACCTGTGGAGGGAGG - Intergenic
1039736655 8:40339823-40339845 ATTTAAACACATGTGAGGCTAGG - Intergenic
1042832814 8:73050309-73050331 CTGGAAACAACTCTGGGACTAGG - Intergenic
1048048052 8:130791773-130791795 CTGTAAACACCTGTGGGGCTCGG - Intronic
1048098683 8:131323162-131323184 CTGTAAAGACCATTGAGGCTAGG - Intergenic
1048741845 8:137569513-137569535 CTCTTAATACCTGTGGGCCTTGG - Intergenic
1051494104 9:17699472-17699494 CTGTACACACGTGTGGGGATTGG - Intronic
1053002625 9:34585726-34585748 TTGTAAACTCCTGTGGCCCTGGG - Intronic
1053640694 9:40075120-40075142 CTGTAATAACCTATGGTGCTTGG + Intergenic
1053765442 9:41390352-41390374 CTGTAATAACCTATGGTGCTTGG - Intergenic
1054321385 9:63671104-63671126 CTGTAATAACCTATGGTGCTTGG + Intergenic
1054544057 9:66301511-66301533 CTGTAATAACCTATGGTGCTTGG - Intergenic
1055692786 9:78851749-78851771 CTGTTAACACCTGAGGGGTGGGG + Intergenic
1057346260 9:94253642-94253664 CAGTAGACACCTATGCGGCTTGG - Intergenic
1058876877 9:109252194-109252216 CTGTATACACCTGTAGGGGCTGG + Intronic
1062600914 9:137318270-137318292 CTGGGAAGCCCTGTGGGGCTGGG - Intronic
1062715227 9:138006883-138006905 CTGTATCCTTCTGTGGGGCTGGG + Exonic
1202788466 9_KI270719v1_random:58202-58224 CTGTAACAACCTATGGTGCTTGG + Intergenic
1186638604 X:11431571-11431593 CTGTTAACAATGGTGGGGCTGGG - Intronic
1186872211 X:13784169-13784191 CTGGAATCACCTGGGGAGCTTGG + Intronic
1187977758 X:24720352-24720374 CTGTAAGCTCCTGGAGGGCTGGG + Intronic
1188289060 X:28366170-28366192 TTGTAAACACCATTGAGGCTAGG - Intergenic
1188959988 X:36479377-36479399 CTGGAAACTCATGAGGGGCTAGG + Intergenic
1195912115 X:109899560-109899582 CTGTAAAGACCATTGAGGCTAGG - Intergenic
1198858710 X:141046143-141046165 CTGTAAAGACCTTCGAGGCTAGG + Intergenic
1199302716 X:146232026-146232048 CTGTAAAGACCTTCGAGGCTAGG - Intergenic