ID: 1048051882

View in Genome Browser
Species Human (GRCh38)
Location 8:130825941-130825963
Sequence TCCTGCGGAAGTAGTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048051882_1048051890 28 Left 1048051882 8:130825941-130825963 CCTGGAGGACTACTTCCGCAGGA No data
Right 1048051890 8:130825992-130826014 ACAAAGTTGGAGACCTCCTAGGG No data
1048051882_1048051885 -2 Left 1048051882 8:130825941-130825963 CCTGGAGGACTACTTCCGCAGGA No data
Right 1048051885 8:130825962-130825984 GATCTTTCAGCCACAGTACTGGG No data
1048051882_1048051886 3 Left 1048051882 8:130825941-130825963 CCTGGAGGACTACTTCCGCAGGA No data
Right 1048051886 8:130825967-130825989 TTCAGCCACAGTACTGGGCATGG No data
1048051882_1048051888 15 Left 1048051882 8:130825941-130825963 CCTGGAGGACTACTTCCGCAGGA No data
Right 1048051888 8:130825979-130826001 ACTGGGCATGGCAACAAAGTTGG No data
1048051882_1048051889 27 Left 1048051882 8:130825941-130825963 CCTGGAGGACTACTTCCGCAGGA No data
Right 1048051889 8:130825991-130826013 AACAAAGTTGGAGACCTCCTAGG No data
1048051882_1048051884 -3 Left 1048051882 8:130825941-130825963 CCTGGAGGACTACTTCCGCAGGA No data
Right 1048051884 8:130825961-130825983 GGATCTTTCAGCCACAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048051882 Original CRISPR TCCTGCGGAAGTAGTCCTCC AGG (reversed) Intronic