ID: 1048053675

View in Genome Browser
Species Human (GRCh38)
Location 8:130843910-130843932
Sequence GAGAGTGACCTGAAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048053670_1048053675 5 Left 1048053670 8:130843882-130843904 CCATAAGGGTATGTGAGATGGCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1048053675 8:130843910-130843932 GAGAGTGACCTGAAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048053675 Original CRISPR GAGAGTGACCTGAAGGAGTT GGG Intronic
No off target data available for this crispr