ID: 1048058296

View in Genome Browser
Species Human (GRCh38)
Location 8:130890717-130890739
Sequence CAGAGACCACAGGCTGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048058288_1048058296 12 Left 1048058288 8:130890682-130890704 CCATTACTACTTCCCAGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 177
Right 1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG No data
1048058291_1048058296 -1 Left 1048058291 8:130890695-130890717 CCAGTGCTGGCTGCTAGAGCACC 0: 1
1: 0
2: 3
3: 16
4: 182
Right 1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG No data
1048058287_1048058296 13 Left 1048058287 8:130890681-130890703 CCCATTACTACTTCCCAGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG No data
1048058290_1048058296 0 Left 1048058290 8:130890694-130890716 CCCAGTGCTGGCTGCTAGAGCAC 0: 1
1: 0
2: 2
3: 8
4: 127
Right 1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG No data
1048058286_1048058296 28 Left 1048058286 8:130890666-130890688 CCAGAGAATGTCACTCCCATTAC 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048058296 Original CRISPR CAGAGACCACAGGCTGGCAA GGG Intronic
No off target data available for this crispr