ID: 1048058643

View in Genome Browser
Species Human (GRCh38)
Location 8:130894261-130894283
Sequence TAGCAGGCACAACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048058643_1048058650 25 Left 1048058643 8:130894261-130894283 CCTCTTTGGGGTTGTGCCTGCTA 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1048058650 8:130894309-130894331 CACACACATTTCTATAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048058643 Original CRISPR TAGCAGGCACAACCCCAAAG AGG (reversed) Intronic
901444682 1:9300945-9300967 ATGAAGGCACAACCCGAAAGTGG + Intronic
901779220 1:11581961-11581983 ATGCAGGCAAAGCCCCAAAGTGG - Intergenic
901903866 1:12391273-12391295 ATGCAGGCACCACCCAAAAGTGG - Intronic
902850040 1:19148074-19148096 TGGCAGGGACAACAGCAAAGTGG + Exonic
903581330 1:24373064-24373086 TGGCAGACACAAGCCCAGAGGGG - Intronic
905354122 1:37369185-37369207 ATGCAGGCACCACCCAAAAGTGG + Intergenic
905465279 1:38148504-38148526 ATGCAGGCACCACCCGAAAGTGG + Intergenic
906930870 1:50168105-50168127 ATGCAGGCACCACCCGAAAGTGG - Intronic
908052365 1:60247115-60247137 ATGCAGGCACCACCCGAAAGTGG + Intergenic
908700757 1:66897686-66897708 TAGTGGGCACAGCCCCAATGGGG - Intronic
908737438 1:67291218-67291240 ATGCAGGCACCACCCGAAAGTGG + Intergenic
909032832 1:70561902-70561924 ATGCAGGCACCACCCAAAAGTGG - Intergenic
909172554 1:72315062-72315084 ATGCAGGCACCACCCGAAAGTGG - Intergenic
909518773 1:76542927-76542949 AAGCAGAAACAACCCCACAGAGG - Intronic
909548894 1:76876779-76876801 ATGCAGGCACCACCCAAAAGTGG - Intronic
909811002 1:79931741-79931763 ATGCAGGCACCACCCGAAAGTGG + Intergenic
910141330 1:84030379-84030401 ATGCAGGCACCACCCCAAAGTGG + Intergenic
910638933 1:89439571-89439593 ATGCAGGCACCACCCAAAAGTGG - Intergenic
910790381 1:91044146-91044168 ATGCAGGCACCACCCAAAAGTGG + Intergenic
911980480 1:104559821-104559843 ATGCAGGCACCACCCGAAAGTGG + Intergenic
912943757 1:114067802-114067824 ATGCAGGCACCACCCGAAAGTGG - Intergenic
913601872 1:120429060-120429082 TAGAAGGGACAAGCCCCAAGTGG - Intergenic
914085171 1:144447543-144447565 TAGAAGGGACAAGCCCCAAGTGG + Intronic
914363055 1:146952699-146952721 TAGAAGGGACAAGCCCCAAGTGG - Intronic
914488623 1:148134440-148134462 TAGAAGGGACAAGCCCCAAGTGG + Intronic
914588989 1:149089521-149089543 TAGAAGGGACAAGCCCCAAGTGG + Intronic
915667624 1:157459242-157459264 ATGCAGGCACCACCCGAAAGTGG - Intergenic
920858434 1:209684121-209684143 TAGGAGACAAAGCCCCAAAGAGG + Intergenic
921302493 1:213764439-213764461 TAGCAGGGACAACCTAAAAGAGG - Intergenic
1067333188 10:45340622-45340644 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1069192256 10:65505967-65505989 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1071267029 10:83973601-83973623 ATGCAGGCACCACCCCAAAGTGG - Intergenic
1073557399 10:104466296-104466318 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1073995822 10:109314313-109314335 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1074970642 10:118533685-118533707 TATCATCCTCAACCCCAAAGGGG - Intergenic
1076772570 10:132674434-132674456 ATGCAGGCACCACCCGAAAGTGG - Intronic
1076927351 10:133498810-133498832 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1077007368 11:364599-364621 AAGCTGGCACCACCCCGAAGTGG + Intergenic
1077489849 11:2855747-2855769 GAGCAGGCACCACCTCAGAGGGG + Intergenic
1079282975 11:19104556-19104578 GAGCATGCAGAACCCTAAAGGGG + Intergenic
1081110525 11:39128790-39128812 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1082756700 11:57083686-57083708 CAGCAGGCTCAAACCCAAACTGG - Intergenic
1082999712 11:59280249-59280271 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1083093196 11:60221505-60221527 ATGCAGGCACCACCTCAAAGTGG + Intronic
1085505005 11:77053393-77053415 TAGCAGCCACATCCCCCAGGTGG + Intergenic
1087374073 11:97320930-97320952 ACGCAGGCACCACCCAAAAGTGG + Intergenic
1088265466 11:107983977-107983999 ATGCAGGCACTACCCGAAAGTGG + Intergenic
1088836714 11:113583768-113583790 GTGCAGGCACCACCCGAAAGTGG + Intergenic
1089343577 11:117776131-117776153 TGGCTGACACAACCCCAGAGAGG + Intronic
1089903662 11:122013991-122014013 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1090209443 11:124907676-124907698 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1092093332 12:5822030-5822052 ACGCAGGCACCACCCAAAAGTGG + Intronic
1092381611 12:8001318-8001340 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1093645772 12:21584050-21584072 ATGCAGGCACCACCCAAAAGTGG + Intronic
1094582141 12:31743449-31743471 AAGCAGGCACTTCCCCACAGAGG + Intergenic
1095121462 12:38424465-38424487 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1095738566 12:45584540-45584562 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1095844339 12:46729595-46729617 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1095856193 12:46863297-46863319 ACGCAGGCACCACCCGAAAGTGG - Intergenic
1096031630 12:48421352-48421374 TAGCAATGACAACTCCAAAGAGG + Intergenic
1096457411 12:51799057-51799079 ATGCAGGCACCACCCAAAAGTGG - Intronic
1097564601 12:61252064-61252086 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1097821300 12:64131525-64131547 ATGCAGGCACCACCCGAAAGTGG - Intronic
1097843305 12:64342387-64342409 ATGCAGGCACCACCCGAAAGTGG - Intronic
1098716141 12:73830188-73830210 GCGCAGGCACCACCCAAAAGTGG + Intergenic
1098964751 12:76775113-76775135 TATCAGGAATAACCACAAAGAGG - Intronic
1099401151 12:82204978-82205000 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1099526410 12:83723488-83723510 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1100241099 12:92711228-92711250 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103268633 12:119652921-119652943 TAGAAGGCACAAAACCAAAATGG + Intergenic
1103396581 12:120611827-120611849 ATGCGGGCACCACCCCAAAGTGG + Intergenic
1104083752 12:125456526-125456548 CAGCAGGCAAAGCCCCACAGAGG - Intronic
1105740168 13:23315560-23315582 ATGCAGGCACCACCCAAAAGTGG + Intronic
1106226549 13:27790810-27790832 TTGCAGGCACCACCCTAGAGTGG + Intergenic
1107983523 13:45755585-45755607 ACGCAGGCACCACCCAAAAGTGG - Intergenic
1109293278 13:60500495-60500517 ATGCAGGCACCACCCAAAAGTGG + Intronic
1109354392 13:61220216-61220238 TAGCAGGAACAACATCACAGGGG - Intergenic
1109557577 13:64000060-64000082 AAACAGGCAAAATCCCAAAGAGG - Intergenic
1111535254 13:89595552-89595574 ATGCAGGCACTACCCGAAAGTGG + Intergenic
1111713733 13:91850975-91850997 CAGAAGGCTCAACTCCAAAGAGG - Intronic
1113319655 13:109221283-109221305 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1114905341 14:27120173-27120195 ACGCAGGCACCACCCAAAAGTGG - Intergenic
1115059763 14:29174273-29174295 GTGCAGGCACCACCCAAAAGTGG + Intergenic
1117237777 14:53796910-53796932 TAGCAGGCTAAACACCATAGTGG - Intergenic
1118385455 14:65252175-65252197 GTGCAGGCACCACCCAAAAGTGG - Intergenic
1118845130 14:69542258-69542280 TATCAGGCACACCACCAAATAGG + Intergenic
1119059648 14:71461811-71461833 ATGCAGGCACCACCCAAAAGTGG - Intronic
1119107509 14:71938462-71938484 ATGCAGGCACCACCCAAAAGTGG - Intronic
1119756012 14:77120206-77120228 AAGCAGTCACAACCCTGAAGGGG - Intronic
1120973758 14:90231212-90231234 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1122021026 14:98838052-98838074 TTGCAGGCACCATCCCAATGTGG + Intergenic
1122962381 14:105101190-105101212 GGGCAGGCACACCCCCAAATCGG - Intergenic
1124990663 15:34670280-34670302 TAGGTGGCAAATCCCCAAAGAGG + Intergenic
1126286458 15:47018513-47018535 TAGCAGGCTCAAGGCCAAACAGG - Intergenic
1128359071 15:66948063-66948085 GCACAGGCACCACCCCAAAGGGG - Intergenic
1128991043 15:72260567-72260589 TACCATGAAGAACCCCAAAGTGG - Exonic
1132231438 15:100187455-100187477 TACCAGGCTCAACCCGCAAGAGG + Intronic
1134625285 16:15718730-15718752 AAGCAGCCACACCCCCAAACAGG + Intronic
1138095813 16:54210541-54210563 TAGCAGGAGCAACTCCAAAAGGG + Intergenic
1140298852 16:73736808-73736830 TAGCAGGCACCAACCCAAACAGG + Intergenic
1141928304 16:87183741-87183763 CAGCAGGCAAAACTCCAAGGTGG + Intronic
1151037759 17:70821219-70821241 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1151951264 17:77355522-77355544 CTGCAGGCACAGCCCCCAAGTGG + Intronic
1155332388 18:24731444-24731466 AAGCAGACTCAATCCCAAAGAGG - Intergenic
1155466240 18:26138871-26138893 TAGCAGGCACATCCAGAAACAGG - Intronic
1156643421 18:39129835-39129857 TAGTAGGCAAAACTCTAAAGAGG - Intergenic
1157341255 18:46780400-46780422 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1161261038 19:3337812-3337834 TAGCAGTCAGACCCCCCAAGAGG + Intergenic
1161560728 19:4971161-4971183 TAGCAGCCCCCTCCCCAAAGAGG - Intronic
1164097040 19:22020976-22020998 AAGCAGGCACCACCTGAAAGTGG - Intergenic
1164402768 19:27912966-27912988 TAGGAGGCACAAGACCAAACAGG - Intergenic
1166345202 19:42161450-42161472 CAGGAGGCCCATCCCCAAAGAGG + Intronic
924994281 2:342709-342731 GAGCAGGCACCTCACCAAAGTGG + Intergenic
925460774 2:4060822-4060844 ATGCAGGCACCACCCGAAAGTGG + Intergenic
927008765 2:18880100-18880122 ATGCAGGCACCACCCAAAAGTGG + Intergenic
931396844 2:61895445-61895467 TAGCAGGACCAAGGCCAAAGAGG - Intronic
933504728 2:83162382-83162404 ATGCAGGCACCACCCGAAAGTGG - Intergenic
934896109 2:98121611-98121633 TAGCTGGAACAACCCAAATGAGG + Intronic
935537057 2:104307432-104307454 CAGCAGGCACACCCCAATAGAGG + Intergenic
936877721 2:117212745-117212767 TAGCAGGCACAAAGGCACAGCGG - Intergenic
937582010 2:123498772-123498794 ATGCAGGCACCACCCAAAAGTGG - Intergenic
937852519 2:126648360-126648382 ATGCAGGCACCACCCAAAAGTGG - Intergenic
938250005 2:129807306-129807328 CAGCAGACACATCACCAAAGAGG - Intergenic
939564284 2:143768378-143768400 TAGAAGGCATAGCACCAAAGGGG - Intergenic
940605869 2:155923910-155923932 ATGCAGGCACCACCCGAAAGTGG - Intergenic
941330617 2:164174188-164174210 ATGCAGGCACCACCCAAAAGTGG - Intergenic
943006940 2:182396205-182396227 GTGCAGGCACCACCCAAAAGAGG + Intronic
943239171 2:185362200-185362222 ATGCAGGCACCACCCGAAAGTGG - Intergenic
943442724 2:187945585-187945607 TGGCAGGCTCAACACCCAAGAGG - Intergenic
946331380 2:219010873-219010895 TTGCTGCCTCAACCCCAAAGGGG - Exonic
946703716 2:222437414-222437436 AGGCAGGCACCACCCGAAAGTGG - Intronic
946790975 2:223300138-223300160 ATGCAGGCACCACCCGAAAGTGG + Intergenic
947246207 2:228051457-228051479 TGGCAGGCATAAGCACAAAGAGG - Intronic
948726366 2:239936468-239936490 TAGCAGGCACAACACCGAGGGGG + Intronic
1173589233 20:44211040-44211062 AAGCAGGCACGCCCCAAAAGCGG - Intergenic
1177569543 21:22870230-22870252 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1179415103 21:41192161-41192183 ATGCAGGCACCACCCGAAAGTGG - Intronic
1180210976 21:46295440-46295462 GAGCAGGCACAGCACCAAGGGGG - Intronic
1184601339 22:45545317-45545339 TAGTAGGACCAACCCCATAGGGG + Intronic
1184603514 22:45557996-45558018 ATGCAGGCACCACCCGAAAGTGG - Intronic
1184618013 22:45651258-45651280 CTGCAGGCACAAGCCAAAAGTGG - Intergenic
1185110601 22:48898170-48898192 TGGCAGGAACAAACCCACAGGGG - Intergenic
949169988 3:986227-986249 ATGCAGGCACCACCCAAAAGTGG - Intergenic
949508495 3:4748283-4748305 TAGTAGGCAGAGCTCCAAAGTGG - Intronic
949905930 3:8858433-8858455 ATGCAGGCACGACCCAAAAGTGG + Intronic
950507067 3:13401583-13401605 AAGCAGGCACAAGCCCACACAGG + Intronic
954374503 3:50186980-50187002 TAGAAGGTACACCCCCAATGTGG - Intronic
954511434 3:51129287-51129309 ATGCAGGCACCACCCGAAAGTGG - Intronic
955617294 3:60822776-60822798 TTGCAGGGATAACCCCAAAGTGG + Intronic
956703846 3:71982510-71982532 ATGCAGGCACCACCCGAAAGTGG - Intergenic
958934355 3:100240989-100241011 ATGCAGGCACCACTCCAAAGTGG + Intergenic
959203605 3:103278870-103278892 TTGCAGGCACCACCCAAAAGTGG - Intergenic
960167691 3:114422298-114422320 TGGCAGCAACAACTCCAAAGGGG - Intronic
960479352 3:118170431-118170453 AGGCAGCCACAACCCCACAGAGG - Intergenic
961410496 3:126716867-126716889 CAGCAGGCTCAGCCTCAAAGGGG - Intronic
963331764 3:143922997-143923019 ATGCAGGCACCACCCGAAAGTGG - Intergenic
964679188 3:159318537-159318559 ATGCAGGCACCACCCAAAAGTGG - Intronic
965251290 3:166347895-166347917 TTGCAGGCACCACCCTAAAGTGG - Intergenic
965893112 3:173539154-173539176 AAGCAGGCACCACCCGAAAGTGG - Intronic
966445743 3:179998936-179998958 ATGCAGGCACCACCCAAAAGTGG + Intronic
967917602 3:194590372-194590394 TGGCTGGCACAGCCCCAAACAGG - Intronic
968907051 4:3458789-3458811 ATGCAGGCACCACCCGAAAGTGG + Intergenic
969947293 4:10797513-10797535 AAGCAGGCAAAAACCTAAAGTGG + Intergenic
971857603 4:32062456-32062478 ACGCAGGCACCACCCAAAAGTGG - Intergenic
971979252 4:33732497-33732519 ATGCAGGCACCACCCAAAAGTGG - Intergenic
973118493 4:46489428-46489450 AAGCAGGCATAACCAGAAAGTGG + Intergenic
973903518 4:55502844-55502866 TAACAGTCATATCCCCAAAGAGG + Intronic
974644565 4:64674391-64674413 ATGCAGGCACCACCCAAAAGTGG - Intergenic
974786438 4:66624408-66624430 ATGCAGGCACCACCCAAAAGTGG + Intergenic
975024587 4:69532552-69532574 CAGCAGACACCACCCAAAAGTGG + Intergenic
977204764 4:94156014-94156036 ATGCAGGCACCACCCGAAAGTGG + Intergenic
977466052 4:97383751-97383773 AAGCAGTCACCACCCAAAAGTGG + Intronic
977490028 4:97699695-97699717 AAGCAGGCACCACCCAAAAGTGG - Intronic
977930358 4:102743442-102743464 ATGCAGGCACCACCCGAAAGTGG - Intronic
979888515 4:126061796-126061818 AGGCAGGCACCTCCCCAAAGTGG - Intergenic
980405840 4:132353413-132353435 ATGCAGGCACCACCCAAAAGTGG - Intergenic
980602252 4:135040397-135040419 ATGCAGGCACCACCCGAAAGTGG + Intergenic
981508247 4:145526890-145526912 TAGCAAACACAAGCTCAAAGAGG - Intronic
982623289 4:157732507-157732529 ATGCAGGCACCACCCAAAAGTGG - Intergenic
984235720 4:177155773-177155795 TTACAAGCACAAGCCCAAAGAGG + Intergenic
986531356 5:8739950-8739972 ATGCAGGCACCACCCAAAAGTGG - Intergenic
987885495 5:23806878-23806900 ATGCAGGCACCACCCAAAAGTGG + Intergenic
988228810 5:28448502-28448524 TTGCAGGCACCACCCAAAAGTGG + Intergenic
991946194 5:71900519-71900541 ATGCAGGCACCACCCAAAAGTGG + Intergenic
992243005 5:74790246-74790268 ATGCAGGCACCACCCAAAAGTGG + Intronic
992261488 5:74975053-74975075 TACCAGCCAAAACCCCAAATGGG - Intergenic
994291317 5:98031574-98031596 ATGCAGGCACCACCCGAAAGTGG - Intergenic
995242499 5:109901064-109901086 TGGCAGGCACCAACCCTAAGGGG - Intergenic
995427681 5:112043349-112043371 ATGCAGGCACCACCCCAAAGTGG - Intergenic
998555820 5:143122746-143122768 TAACAGGCAAATCCCCAAACAGG - Intronic
999351427 5:150875223-150875245 ATGCAGGCACCACCCAAAAGTGG + Intronic
1000417017 5:160994277-160994299 ATGCAAGCACCACCCCAAAGTGG + Intergenic
1003791277 6:9550423-9550445 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1008340321 6:50356744-50356766 AGGCAGGCACCACCCAAAAGTGG + Intergenic
1008400338 6:51055843-51055865 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1008996296 6:57664217-57664239 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1009184815 6:60563015-60563037 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1009851875 6:69208579-69208601 ATGCAGGCACCACCCTAAAGTGG - Intronic
1010938193 6:81886033-81886055 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1012920741 6:105219166-105219188 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1015999694 6:139029643-139029665 TACCAGGCAGAACCCCAAGCTGG + Intronic
1016132796 6:140497659-140497681 ATGCAGGCATCACCCCAAAGTGG - Intergenic
1016147275 6:140692337-140692359 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1018122873 6:160654844-160654866 ATGCAGGCACCACCCGAAAGTGG - Intronic
1018599934 6:165527913-165527935 ATGCAGGCACCACCCAAAAGTGG + Intronic
1018803736 6:167242614-167242636 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1019177689 6:170168690-170168712 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019178144 6:170171159-170171181 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019178191 6:170171439-170171461 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019178241 6:170171739-170171761 AGGCAGGAACAACCCCAAACAGG - Intergenic
1019279767 7:193766-193788 CACCAGGCTCAGCCCCAAAGCGG + Exonic
1020347551 7:7182346-7182368 TAGCAGACACAAGCCGCAAGGGG + Intronic
1022078938 7:27000707-27000729 ATGCAGGCACCACCCTAAAGGGG + Intergenic
1023035583 7:36128713-36128735 GAACAGGCACACTCCCAAAGGGG - Intergenic
1026082172 7:67231585-67231607 CAGCAGGTCCAACCTCAAAGGGG - Intronic
1027556040 7:79665887-79665909 TAGCAGCAAAAAACCCAAAGGGG - Intergenic
1028043907 7:86091843-86091865 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1028141785 7:87282360-87282382 ATGCAGGTACAACCCAAAAGTGG + Intergenic
1028237874 7:88383199-88383221 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1028609845 7:92698507-92698529 TAGCTGGCAGAACCCCAAACAGG - Intronic
1028935066 7:96455441-96455463 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1029961305 7:104691426-104691448 ATGCAGGCACAACCAGAAAGTGG + Intronic
1030931236 7:115525305-115525327 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1031474402 7:122204979-122205001 ATGCAGGCACCACCCCAAAGTGG - Intergenic
1031833052 7:126650390-126650412 ATGCAGGCACCACCCAAAAGAGG + Intronic
1032372211 7:131368125-131368147 TAGCAGTCACTACCCTAAACTGG + Intronic
1033764107 7:144468941-144468963 CAGCAGGCACAACACTAAAAAGG - Intronic
1036503146 8:9331785-9331807 TAGGAACCAAAACCCCAAAGGGG - Intergenic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1039324121 8:36466157-36466179 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1041934601 8:63321707-63321729 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1046128623 8:109941225-109941247 AAGGAGGCACCACCCGAAAGTGG - Intergenic
1046197604 8:110884598-110884620 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1048058643 8:130894261-130894283 TAGCAGGCACAACCCCAAAGAGG - Intronic
1048683620 8:136875543-136875565 TAGCAGGCACAGCTCCAATGAGG + Intergenic
1050482722 9:6102978-6103000 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1050901837 9:10960008-10960030 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1052227635 9:26108753-26108775 ATGCAGGCACCACCCAAAAGTGG + Intronic
1053507599 9:38656837-38656859 TAACAGGCACATCCCCAAAGAGG + Intergenic
1053943657 9:43280421-43280443 TGGCAGGCATAAACCCAAGGCGG + Intergenic
1055903888 9:81270828-81270850 ATGCAGGCACTACCCGAAAGTGG - Intergenic
1056753520 9:89368247-89368269 CAGCGGGCACATCCCCAGAGGGG + Intronic
1058019947 9:100076457-100076479 ATGCAGGCACCACCCAAAAGTGG + Intronic
1058297442 9:103326875-103326897 GAGCAGGGACACCCCAAAAGAGG - Intergenic
1058519379 9:105803538-105803560 TAGCAGGAACAATATCAAAGCGG + Intergenic
1058960605 9:109989470-109989492 TTGAAGGCACAATTCCAAAGGGG - Intronic
1059524718 9:114980070-114980092 TAGCAGGTAAGACCCCAAAGGGG + Intergenic
1060364783 9:123000104-123000126 TAGCAGGCAAAATTCTAAAGTGG - Intronic
1061318053 9:129809663-129809685 AAACAGGCAAAACCCCAAAGCGG - Exonic
1062309770 9:135929458-135929480 ATGCAGGCACCACCCCACAGGGG + Intergenic
1203586775 Un_KI270747v1:10324-10346 TGGCAGGCATAAACCCAAGGCGG + Intergenic
1189119686 X:38381054-38381076 AACCAGGCATAGCCCCAAAGAGG + Intronic
1189154832 X:38746345-38746367 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1190721581 X:53153240-53153262 ATGTAGGCACCACCCCAAAGTGG - Intergenic
1191629986 X:63312210-63312232 ATGCAGGCACTACCCTAAAGTGG - Intergenic
1191719190 X:64215330-64215352 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1191946401 X:66539394-66539416 ATGCAGGCACAACCCGAAAGTGG + Intergenic
1192898750 X:75472280-75472302 ATGCAGGCACCACCCAAAAGTGG + Intronic
1192996241 X:76515951-76515973 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1193287984 X:79736609-79736631 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1193833001 X:86310480-86310502 ATGCAGGCACCACCCAAAAGTGG + Intronic
1193914755 X:87351560-87351582 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1195782305 X:108479490-108479512 ATGCAGGCACCACCCGAAAGTGG - Intronic
1197084155 X:122453124-122453146 ATGCAGGCACCACCCAAAAGTGG - Intergenic
1197182143 X:123548164-123548186 ATGCAGGCACCACCCAAAAGTGG + Intergenic
1197372008 X:125637492-125637514 ATGCAGGCACCACCCGAAAGTGG - Intergenic
1198701349 X:139400672-139400694 ATGCAGGCACCACCCGAAAGTGG + Intergenic
1198782992 X:140257422-140257444 GTGCAGGCACCACCCGAAAGTGG - Intergenic
1199021295 X:142881485-142881507 ATGCAGGCACCACCTCAAAGGGG + Intergenic
1199040642 X:143111474-143111496 ATGCAGGCACCACCCGAAAGAGG + Intergenic
1199697313 X:150351972-150351994 TAGCAGGAACAAGCCCTGAGCGG + Intergenic
1201072876 Y:10165482-10165504 TGGGAGGCACAACCCCTTAGGGG - Intergenic
1201862668 Y:18616387-18616409 TAGCAGACACATCTCTAAAGGGG + Intergenic
1201870655 Y:18703993-18704015 TAGCAGACACATCTCTAAAGGGG - Intergenic