ID: 1048059065

View in Genome Browser
Species Human (GRCh38)
Location 8:130898866-130898888
Sequence CCTGTGAAGAATGGACTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048059065 Original CRISPR CCTGTGAAGAATGGACTGTC GGG (reversed) Intronic
902695876 1:18140582-18140604 ACTGTGAAGCATGGTCTGGCTGG - Intronic
905112486 1:35606027-35606049 ACAGTGAAGAATGGAATGTAAGG + Intronic
905632423 1:39526037-39526059 CCTGTGCTGACTGCACTGTCTGG + Intergenic
911041902 1:93597979-93598001 CCTGTCAAGACTGGACTTGCTGG - Intronic
911862468 1:102970244-102970266 CCTGGGAAGGATGGGCTGCCAGG - Exonic
915264063 1:154702514-154702536 CCAGTGCAGAATGGAGAGTCTGG + Exonic
918257870 1:182766291-182766313 CCCATGAAGAATGGATTGTAAGG - Intergenic
919795046 1:201316531-201316553 CCTGTGAAGAATAGGCAGTGGGG - Exonic
920057427 1:203202642-203202664 CCTGAGAAGGCTGGCCTGTCAGG - Intergenic
920438236 1:205961884-205961906 CTTGTGAAGAATGGGCTGGCTGG + Intergenic
1062951955 10:1510737-1510759 CCAGTGAAGAAGGGACTGTAGGG - Intronic
1063054079 10:2484422-2484444 GCTGTGATGAAGGGACTGTGTGG + Intergenic
1063087568 10:2833294-2833316 CCTGTGGAGCGTGGATTGTCAGG - Intergenic
1063281860 10:4638235-4638257 CCTGTTGAGAATGGAATGTAAGG - Intergenic
1064113300 10:12556809-12556831 ACTGAGAAGAATGGACTGGGGGG + Intronic
1066086526 10:31977171-31977193 CATGTTAAGATTGGAGTGTCTGG + Intergenic
1066382315 10:34912060-34912082 CCTCTGCAGAAAGGACTGCCTGG + Intergenic
1066462084 10:35620969-35620991 CCTCTGAGGGATGGACCGTCTGG + Intergenic
1067778016 10:49176981-49177003 CCCCTGAAGAATGGACTGCAGGG - Intronic
1070147716 10:73786672-73786694 CCTATGAACTATGGACTCTCTGG - Intronic
1070850531 10:79558948-79558970 CCTGGGAATAATGGGCTGCCTGG - Exonic
1071383226 10:85092561-85092583 GCTGGCAACAATGGACTGTCAGG + Intergenic
1076204147 10:128581862-128581884 CCTGTGAGGTGTGGACTGTCTGG + Intergenic
1076692779 10:132232233-132232255 CCTCTGAGGCCTGGACTGTCAGG + Intronic
1078657197 11:13252755-13252777 CGTATGAAGAATAGACTGTAGGG - Intergenic
1078954780 11:16179770-16179792 TCTCTTAAGAATGGACTGGCTGG - Intronic
1079792717 11:24759096-24759118 GCAGTGAAGAATGGGCTCTCAGG + Intronic
1080021025 11:27560328-27560350 AATGTGAAGAATAGACTGACAGG + Intergenic
1085082599 11:73646851-73646873 ACAGTGAAGAATGGACTGGCGGG - Intronic
1085376928 11:76072200-76072222 ACTGAGAGGAATGGACAGTCAGG + Intronic
1086014517 11:82150497-82150519 CCTGTGAAAAATTGAGTTTCTGG + Intergenic
1086175207 11:83883824-83883846 TTTGTGAAGAATGGTCTGTGGGG - Intronic
1088979635 11:114850464-114850486 TCTGTGAACTGTGGACTGTCCGG + Intergenic
1089032286 11:115344800-115344822 CATGTGAAGGATGGACTGAATGG - Intronic
1090253007 11:125264206-125264228 CCAGTGGAAAATGGATTGTCTGG + Intronic
1090315171 11:125779919-125779941 TCTGTGGAGAATGGACTGGAGGG - Intergenic
1090613631 11:128494809-128494831 CATGTGAAGACTGGAGCGTCTGG + Intronic
1092161367 12:6317161-6317183 CCTGGGAGGGAGGGACTGTCAGG + Intronic
1096194928 12:49643602-49643624 CCTGTGAAGAATGAACAGAGGGG + Exonic
1096810904 12:54169218-54169240 TGTGTGGAGAATGGACTGTAGGG + Intronic
1099199134 12:79655137-79655159 CTTGTTAAGAATAGAATGTCAGG + Intronic
1099468312 12:83014947-83014969 CCTGTAAAGAATTGAATTTCTGG + Intronic
1103026473 12:117578181-117578203 ACTGTGAAGAAGTGACAGTCAGG - Intronic
1104564210 12:129865631-129865653 TGTGTGAAGAATGAACTGTGGGG + Intronic
1104591434 12:130087333-130087355 CCTGTGGCGACTGGCCTGTCGGG - Intergenic
1107190859 13:37583968-37583990 CCTGTGAATAATGCATTTTCTGG - Exonic
1108700290 13:52937998-52938020 CCTGTTAAGAATGTCCTGTACGG - Intergenic
1110391920 13:74984115-74984137 CATGTGGAGAATAGACTGTAGGG - Intergenic
1115223963 14:31084832-31084854 CCTTTGAATGATGAACTGTCTGG - Exonic
1119812177 14:77531388-77531410 CCTGTGAAGAAATAACTTTCAGG - Intronic
1120893898 14:89512776-89512798 ACTGTGAAGCAAGTACTGTCAGG + Intronic
1121285044 14:92728746-92728768 GCTGTGGAGCATGGACTGCCTGG + Intronic
1202906019 14_GL000194v1_random:72915-72937 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1124597659 15:31103960-31103982 CCTCTGGAGAGTGGACAGTCTGG - Intronic
1126429056 15:48561098-48561120 CCAGTGATGAGTGGTCTGTCAGG + Intronic
1128862432 15:71085160-71085182 CATGTGAAGTATTGTCTGTCAGG - Intergenic
1129126078 15:73442628-73442650 TCGGTGAAAAATTGACTGTCGGG + Intergenic
1129480021 15:75816240-75816262 CCTGTGATGACTGGAGTGTCTGG + Intergenic
1130149870 15:81303377-81303399 TCTGTAAAGAATGGACCTTCAGG - Intronic
1132078831 15:98847277-98847299 CCTGTAAAGAGTGGACTGTCCGG - Intronic
1132462753 16:63490-63512 CCTGAGCAGAAGGGACTCTCTGG - Intronic
1132509607 16:332135-332157 GCTGTGAACAGAGGACTGTCAGG - Intronic
1135062865 16:19285884-19285906 CCTGTGCAGAGTGGAGGGTCAGG - Exonic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1139783121 16:69368155-69368177 CCTTTGAGGAATGGCCAGTCAGG + Intronic
1141539597 16:84709544-84709566 CCAGTGAAGAATAGACTCACGGG + Intronic
1144229808 17:13190639-13190661 TGTGTGAAGAATGGATTGTTGGG + Intergenic
1144253621 17:13443957-13443979 CCTGAGAACACTGGACTTTCGGG + Intergenic
1147967921 17:44203823-44203845 CATGTGAAGAATGGGCTGTAGGG + Intergenic
1148060179 17:44830535-44830557 GCTTGGAAGAATGAACTGTCCGG - Intronic
1151937854 17:77274276-77274298 CCTGCCAAGAATGGAGGGTCTGG - Intergenic
1153979137 18:10294461-10294483 CCTGTCAAGATTGCAGTGTCAGG + Intergenic
1155410231 18:25535975-25535997 ACTGTGAAGAAAGGACACTCAGG + Intergenic
1161608465 19:5228045-5228067 CCTGGGAGGGATGGACTGTGAGG - Intronic
1161965287 19:7544514-7544536 ACTGTGGATAATGGACTGTATGG - Intronic
1163712598 19:18855570-18855592 GCTGTGAAGCCTGGGCTGTCTGG + Intronic
1166514864 19:43438776-43438798 CCTGAGTAGAATGGGCTGGCTGG - Intergenic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1166839688 19:45689299-45689321 TCTGTGGAGAACAGACTGTCAGG - Intronic
1167387437 19:49172038-49172060 CCTCAGAAGAATAGACTGTCAGG - Exonic
926544797 2:14226274-14226296 CCTGTGAACATTGCACTGTATGG - Intergenic
929826315 2:45311504-45311526 CAGGTGAAGAATGGACTGAGGGG - Intergenic
937048847 2:118871696-118871718 AGTGTGGAGAATGGACTGTGGGG - Intergenic
948391515 2:237614738-237614760 GCTGAGCAGAGTGGACTGTCGGG - Intergenic
1169700450 20:8440547-8440569 CCTGGGAAGACTGAATTGTCTGG - Intronic
1170281027 20:14649233-14649255 ACCATGAAGTATGGACTGTCTGG + Intronic
1171302356 20:24074710-24074732 CTTGTGAAGAATGAACTGAGAGG + Intergenic
1171305698 20:24104096-24104118 CCTTTGATGAATGGACAGTGGGG - Intergenic
1172032104 20:31989486-31989508 CATGTGGAGAATGGACTGTAGGG + Intronic
1172863647 20:38077766-38077788 CATGTGAAGAATGGATTATAGGG - Intronic
1173864849 20:46307398-46307420 ACTGTGAAGAGTGGACTGCGTGG - Intronic
1174266085 20:49333195-49333217 CTTGTGAAGGATGGATTGTGGGG + Intergenic
1175697205 20:61111408-61111430 CCTGTGCATAATGGATGGTCAGG + Intergenic
1176267281 20:64216840-64216862 CCGGTGAAGAATGGCCTGCAGGG - Intronic
1176625374 21:9087671-9087693 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1176867884 21:14063861-14063883 CCTGAGGAGGATGGCCTGTCTGG - Intergenic
1179082626 21:38187087-38187109 CTTCTGAAGAAAGGACTTTCAGG - Intronic
951170770 3:19539304-19539326 ACTGTGATGAATAGACTGTAGGG - Intergenic
952212123 3:31238616-31238638 CCTTAGTAAAATGGACTGTCGGG - Intergenic
952529924 3:34252938-34252960 CCTGTGAAGCATGATCTTTCAGG + Intergenic
953154221 3:40354128-40354150 TTTGTGAAGAATTGACTGTAGGG - Intergenic
954237677 3:49269479-49269501 CAGGTGAAGAATAGCCTGTCTGG - Exonic
954416438 3:50395684-50395706 CCTCTGAAGCATGGACTAGCAGG + Intronic
960941861 3:122940113-122940135 CCTGTGCAGGCTGGACTGTGGGG - Intronic
966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG + Intergenic
966930861 3:184674615-184674637 GCTGTGAATAATGGAGTGTCAGG + Intronic
968284913 3:197502854-197502876 CCTGGGAAGAAAGGGCTGTTAGG - Intergenic
969502351 4:7560758-7560780 CCAAAGAAGAATGGAATGTCGGG - Intronic
969977577 4:11119690-11119712 GTTGTTAAGAATAGACTGTCTGG - Intergenic
970331172 4:14985968-14985990 CTTGTGAAGAGTGGACACTCAGG + Intergenic
971622004 4:28867070-28867092 CCTGGGGAGAATGGACTCTATGG + Intergenic
973535600 4:51878986-51879008 CCTGTGAAGATTTGTCTGACTGG - Intronic
973855994 4:55010249-55010271 CATGTTAAGAATGGGCTGTGAGG - Intergenic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
976334474 4:83869728-83869750 TGTGTGAAGAATGGACTGGTGGG - Intergenic
976804581 4:89032337-89032359 AGTGTGAAGACTGGACTATCTGG + Intronic
979428224 4:120594207-120594229 CGTGTGGAGAATGGATTGTGGGG + Intergenic
981719872 4:147790401-147790423 CCTTTAAAAAATGGGCTGTCTGG + Intronic
983383412 4:167025799-167025821 CCTCTGAGGAATGCATTGTCAGG + Intronic
983386471 4:167069680-167069702 CCTGTGAACAAGGGATTGTTTGG - Intronic
985571529 5:648318-648340 ACTGTGAGGCATGGACTGTGAGG + Intronic
985571639 5:649280-649302 ACTGTGAGGCATGGACTGTGAGG + Intronic
985571652 5:649398-649420 CCTGTGAGGCGTGGACTGTGAGG + Intronic
985571683 5:649664-649686 CCTGTGAGGCGTGGACTGTGAGG + Intronic
986104809 5:4649639-4649661 CATGTGAAGTATTGACTGCCTGG - Intergenic
987906802 5:24088266-24088288 CCTGGGATGAAGGGACTGTGGGG + Intronic
989644035 5:43609963-43609985 CCTGTGCAGAACAGACTGTAGGG - Intronic
989791951 5:45415285-45415307 GCTTTGAAGAATGGACTGAAAGG - Intronic
991507835 5:67343318-67343340 CCTGTGAAGCATGGAAACTCAGG - Intergenic
992459423 5:76946101-76946123 TCTGTGAAGGATTGACTGCCTGG + Intergenic
995577663 5:113558305-113558327 TCTCTGAAGAATGGATTGGCAGG + Intronic
997224009 5:132195241-132195263 CCTGTGAAGAAAGGACAGGGAGG - Intronic
997238146 5:132287279-132287301 CCTGTGAAGATTGAGCAGTCGGG + Intronic
998593177 5:143499580-143499602 GCTGTGAACAATGGATTGTCAGG + Intergenic
999218746 5:149957914-149957936 CCTGGGAAGAATGGGTGGTCAGG + Intergenic
999545120 5:152620310-152620332 CCTGTGGAGAGTGGATTGACTGG + Intergenic
999742826 5:154569474-154569496 GCTGTGAAGAATAAACTATCTGG + Intergenic
1000369869 5:160524711-160524733 TCTGTGATGAATGGGCTCTCTGG + Intergenic
1000593132 5:163182686-163182708 CCTGTGAATAATGGACTTTTTGG + Intergenic
1002099798 5:176851704-176851726 CAGGGGAAGAATGTACTGTCAGG + Intronic
1005632789 6:27724389-27724411 CCTGTGAAGAAGTCACTGTTAGG + Intergenic
1005659761 6:27984680-27984702 GCTGGGAAAAAGGGACTGTCTGG - Intergenic
1005660252 6:27990991-27991013 AGTGTGAAGAATGGACGGTAAGG + Intergenic
1006296778 6:33173373-33173395 CCTGGGAAGGATGGGCTGCCGGG - Exonic
1008029695 6:46680548-46680570 CCTGTGAAGAATGGATTTCAGGG - Intergenic
1008911059 6:56733771-56733793 CCAGTAAAGAAAGGCCTGTCTGG + Intronic
1009479641 6:64140677-64140699 GCTGTGTAGAAAGGACTGCCTGG - Intronic
1010327829 6:74586314-74586336 TCTGTGGAGAATGGATTGTAGGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1016520623 6:144942757-144942779 CCTGTGGAGAATAGACTGAAAGG - Intergenic
1016555695 6:145334667-145334689 TATGTGGAGAATGGACTGTTTGG - Intergenic
1017007843 6:150040847-150040869 CCTGTTAAGATTGGCCAGTCAGG - Intergenic
1017068585 6:150552056-150552078 CCTCGGAAGAATGCACAGTCAGG + Intergenic
1018000209 6:159572216-159572238 CCTGAGAAGATTGGTATGTCTGG - Intergenic
1019905115 7:4056836-4056858 CCGGAGCAGAATGGTCTGTCGGG - Intronic
1026561718 7:71455943-71455965 CCTGTGAAGATTAGACTGTGAGG + Intronic
1030115541 7:106059802-106059824 CCTGGGAAGCCTGGCCTGTCAGG + Intergenic
1031867152 7:127050117-127050139 TATGTGAAGAATGGACTGGAAGG + Intronic
1036828076 8:11994758-11994780 CCTGTGAATCAAGGACTGTTGGG + Intronic
1041901276 8:62985731-62985753 TCTGTGATGAATGCACTGTGAGG - Intronic
1041913430 8:63114423-63114445 GCTATGTAGAATGGACTTTCAGG - Intergenic
1042312976 8:67396865-67396887 TCAGGGAACAATGGACTGTCTGG + Intergenic
1042562646 8:70084612-70084634 CCTATGAAGGATGAACTGCCAGG + Intergenic
1043138962 8:76564038-76564060 CCTGGGAAGGATGGACTGGGTGG - Intergenic
1044261809 8:90133700-90133722 CCTGTGAAGGATGGCCTGAATGG + Intergenic
1048059065 8:130898866-130898888 CCTGTGAAGAATGGACTGTCGGG - Intronic
1050804764 9:9660306-9660328 TCTGTGAAGAATAGACTATAGGG + Intronic
1053462299 9:38280390-38280412 CCTGGGAAGAAGGGAGTCTCAGG - Intergenic
1053656589 9:40222946-40222968 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053906944 9:42852168-42852190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054357008 9:64071393-64071415 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054368694 9:64369168-64369190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054528025 9:66153339-66153361 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1055248124 9:74271730-74271752 CTTGTGAAAAATGGAATTTCTGG + Intergenic
1057248066 9:93474891-93474913 ACGGTGAAGAATGAAGTGTCTGG - Intronic
1058375037 9:104313225-104313247 CCTGATAAGAATGGGCTGTTGGG - Intergenic
1060171265 9:121463213-121463235 CGTGTGAAGAATGGACTGTAGGG + Intergenic
1061453045 9:130678861-130678883 CCTGGCCAGAATAGACTGTCTGG + Intronic
1062131666 9:134898000-134898022 CCTGCCAAGAATGGAGTTTCAGG + Intergenic
1203748548 Un_GL000218v1:58132-58154 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1203561172 Un_KI270744v1:59888-59910 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1186586925 X:10885109-10885131 CCTTTGAAGGATGCTCTGTCAGG - Intergenic
1187263903 X:17713150-17713172 CATGTGAAGAAGGCATTGTCAGG + Intronic
1187293010 X:17973412-17973434 CCTATGAATAATGGACTCCCTGG - Intergenic
1188200007 X:27285663-27285685 CCTATGAAGAATGGCCGATCTGG - Intergenic
1189053770 X:37676258-37676280 GCTATGAGGAATGGATTGTCAGG + Exonic
1192312344 X:70027494-70027516 CCTGTGATGAGTGTACTGTCAGG - Intronic
1194159783 X:90436397-90436419 CTTGAGCAGAATGGGCTGTCTGG - Intergenic
1195262736 X:103149535-103149557 ACTGTGAAGAATGGTTTGTCTGG + Intergenic
1196196949 X:112846657-112846679 ACTGAGAAGTATGGACAGTCTGG - Intergenic
1197588826 X:128383778-128383800 CCTGTGAGGAATGGCCTGCTAGG - Intergenic
1198507940 X:137319731-137319753 CGTGTGGAGAATGGACTGTAGGG - Intergenic
1200506084 Y:4013363-4013385 CTTGAGCAGAATGGGCTGTCTGG - Intergenic
1201161892 Y:11173102-11173124 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic