ID: 1048060075

View in Genome Browser
Species Human (GRCh38)
Location 8:130909857-130909879
Sequence CCGCACATACCTGTTGACAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048060071_1048060075 12 Left 1048060071 8:130909822-130909844 CCAATCCTCATGTCAACATCGTG 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG 0: 1
1: 0
2: 0
3: 4
4: 47
1048060072_1048060075 7 Left 1048060072 8:130909827-130909849 CCTCATGTCAACATCGTGTTTTG 0: 1
1: 0
2: 1
3: 3
4: 92
Right 1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG 0: 1
1: 0
2: 0
3: 4
4: 47
1048060070_1048060075 24 Left 1048060070 8:130909810-130909832 CCGGAGTGGATTCCAATCCTCAT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG 0: 1
1: 0
2: 0
3: 4
4: 47
1048060069_1048060075 29 Left 1048060069 8:130909805-130909827 CCGAGCCGGAGTGGATTCCAATC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048060075 Original CRISPR CCGCACATACCTGTTGACAT AGG Exonic
911361714 1:96884917-96884939 CAGCACATACGTGTTTACAGAGG + Intergenic
1062958598 10:1556720-1556742 CCACACAACTCTGTTGACATGGG - Intronic
1081272147 11:41097849-41097871 CCTCACATCCCTGTTCATATTGG + Intronic
1089358358 11:117870381-117870403 CCCCACACACCTGCTGACAAAGG + Intronic
1089700905 11:120243214-120243236 CCGCACATACCTGCTGATGGCGG - Intronic
1090491448 11:127164694-127164716 TGGCCCTTACCTGTTGACATTGG - Intergenic
1092660239 12:10731008-10731030 CCGTACATACCTGCAGAAATAGG + Intergenic
1101211428 12:102538758-102538780 CTGGACATACCTGTTGACTTTGG - Intergenic
1103907206 12:124333811-124333833 CCGCACACCCCTGTAGACACAGG - Intronic
1106469231 13:30039811-30039833 CCTCACAGACCTGTTGTCAGGGG + Intergenic
1108474728 13:50802496-50802518 CTCAACATAGCTGTTGACATAGG - Intronic
1109766083 13:66899808-66899830 CCTGACATACCTTTTGTCATTGG - Intronic
1115814040 14:37143376-37143398 CCACACATACCTGCTGTCACAGG + Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1137070155 16:35898058-35898080 CAGCACCTACCTGTTGAGACAGG + Intergenic
1147474063 17:40693185-40693207 CAGGAGAAACCTGTTGACATTGG - Intergenic
1150987652 17:70216296-70216318 CCAGACTTGCCTGTTGACATAGG + Intergenic
1156458697 18:37309066-37309088 CCCCACATACCCTTTGGCATGGG - Intronic
1161753799 19:6116746-6116768 TGCCACATTCCTGTTGACATAGG + Intronic
929205546 2:39288120-39288142 CCACACAAACCTGTTGCCTTAGG - Exonic
930729335 2:54712654-54712676 CGGCAAATATCGGTTGACATGGG - Intergenic
943565670 2:189513375-189513397 CCACCCAGAACTGTTGACATTGG - Intergenic
946542753 2:220703423-220703445 CCACACATACCTTCTGCCATTGG + Intergenic
1169508580 20:6240003-6240025 CAGCACATCCCTGTGGGCATAGG - Intergenic
1171394256 20:24821283-24821305 CCCCACTTCCCTGTGGACATAGG - Intergenic
1173653385 20:44682182-44682204 ATGCACATACCTGTGGACATGGG - Intergenic
1175480166 20:59305032-59305054 CTGCACATCCCTGTAGACAGGGG + Intronic
1179265135 21:39796351-39796373 CAGCACGAACCTGGTGACATAGG - Intronic
1181771144 22:25126538-25126560 CCTCAGCTACCTGTTTACATGGG - Intronic
1181807291 22:25382908-25382930 CCTCACATACCTGCTCACATAGG + Intronic
957014546 3:75047660-75047682 CCTGACAGACCTGTTGAGATTGG + Intergenic
983317696 4:166153092-166153114 CCGGATATATCTCTTGACATTGG - Intergenic
983816856 4:172140502-172140524 CCTCATATACCTTCTGACATAGG + Intronic
997652645 5:135533974-135533996 CCGCAGCTACCTGTTGAGGTAGG - Intergenic
999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG + Exonic
999078009 5:148815500-148815522 CCTCACATACCTGGTGCCCTAGG + Intergenic
1001303762 5:170556546-170556568 CCCCTCTTCCCTGTTGACATCGG - Intronic
1004439112 6:15630316-15630338 GCACAAATACCTGTTGACCTTGG - Intronic
1005839797 6:29736083-29736105 ATGCACAGACCTCTTGACATGGG - Intronic
1008594367 6:53026541-53026563 TCCCACATACCTGTTGAAGTAGG + Intronic
1014728012 6:124996567-124996589 CCCCACAGCTCTGTTGACATTGG + Intronic
1018035631 6:159878882-159878904 GGGCACAGACTTGTTGACATAGG - Intergenic
1032435214 7:131895269-131895291 CCTCCCATGCCTGTGGACATGGG + Intergenic
1034079172 7:148260827-148260849 CCTCACATGCCTGTAAACATTGG - Intronic
1041103839 8:54422604-54422626 CAGAACACACCTGTTGACTTTGG - Intergenic
1044247899 8:89970707-89970729 CCGCAGAGACCTGTTGAACTAGG - Intronic
1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG + Exonic
1048886966 8:138916461-138916483 CAGCACATACTTGTTGACACAGG + Intergenic
1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG + Intergenic
1061523830 9:131140698-131140720 AGGCACATACCTGGTGACTTGGG - Exonic
1186801705 X:13099217-13099239 CCACACATCCCTGTTGAAAAAGG - Intergenic
1190709719 X:53058305-53058327 CCCTACAAACCTGTTTACATAGG - Intronic