ID: 1048061217

View in Genome Browser
Species Human (GRCh38)
Location 8:130921019-130921041
Sequence CTGGAGAAACAGAACCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 3, 2: 29, 3: 106, 4: 487}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048061217 Original CRISPR CTGGAGAAACAGAACCAACA GGG (reversed) Intronic
901182087 1:7348687-7348709 CTGGAGAAAAAGCAGCCACAGGG + Intronic
901378870 1:8859532-8859554 CCTGAGAAGCAGAACCAATAAGG - Intergenic
902164319 1:14557598-14557620 CCAGAGAAACAAAACCAATAGGG + Intergenic
902302663 1:15513322-15513344 CCAGAGAAAGAGAACCAATAGGG - Intronic
902692420 1:18118170-18118192 CTGTAGAAAGAGAAACAAAAGGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
903787692 1:25872297-25872319 TTGGAGAAACAGGGCCAAGAGGG - Intergenic
903844761 1:26272338-26272360 CTGGAGATCCTGAACCTACAAGG + Intronic
905664448 1:39754272-39754294 CTAGAGAAGCAGAACCAATAGGG + Intronic
905785186 1:40749889-40749911 GTGGAGAAACACAATCACCATGG - Intronic
905859562 1:41341210-41341232 TTAGAGAAACAGAACCACTAGGG + Intergenic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
906900096 1:49825874-49825896 CCAGAGAAACAGAACCAAAAAGG - Intronic
906906675 1:49901915-49901937 CTTGACAAACATAAACAACAAGG + Intronic
906974392 1:50553810-50553832 CTGCAAAACCAGAACCAAAAAGG + Intronic
907613552 1:55899308-55899330 CTGGAGAAATAGAACCAATAGGG - Intergenic
907944655 1:59124341-59124363 CTGGGGAGACAGACCCAAGAAGG - Intergenic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
908936166 1:69378661-69378683 TCAGAGAAACAGAACCAATAAGG + Intergenic
910458929 1:87427253-87427275 CTGGAGAAGCAAATGCAACAAGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
910861641 1:91747962-91747984 CTAGAGAAACAGAACCAGTCGGG - Intronic
911889501 1:103349370-103349392 CTAGAGAGACAGAACCAATAAGG + Intergenic
912085334 1:105995560-105995582 CTAGAGGAACAGAACCAATAGGG + Intergenic
912185853 1:107275030-107275052 CCAGGGAAACAGAACTAACAGGG + Intronic
912555872 1:110515736-110515758 CCAGAGAAACAGAGCCAATAGGG - Intergenic
912724720 1:112048737-112048759 CCAGAGAAAAAGAACCAATATGG - Intergenic
912744962 1:112238530-112238552 GCAGAGAAACAGAATCAACAGGG - Intergenic
913483021 1:119307429-119307451 CTAGAGAAACAGAACCAATAGGG - Intergenic
913484542 1:119321897-119321919 CCATAGAAACAGAACCAAAAAGG + Intergenic
913568153 1:120093957-120093979 CTTGAGAAACAGCAGCAACTGGG + Intergenic
914264136 1:146023070-146023092 CTAGAGGAACAGAACTAATAGGG + Intergenic
914316211 1:146514152-146514174 CTGGAGAAGCAAATGCAACAAGG - Intergenic
914498144 1:148219209-148219231 CTGGAGAAGCAAATGCAACAAGG + Intergenic
914549997 1:148705724-148705746 CTTGAGAAACAGCAGCAACTGGG + Intergenic
915097112 1:153470990-153471012 CTGGGGAAAGGGGACCAACAGGG - Intergenic
916068296 1:161154117-161154139 CTGTAGAAACACAACTAACCCGG - Exonic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
917276843 1:173340371-173340393 CCAGAGAAACAGAACTAATAGGG - Intergenic
917469272 1:175312685-175312707 CCAGAGAAACAGAACCAATAGGG - Intergenic
917766383 1:178223186-178223208 ATGGAGAATCAAAACAAACATGG + Intronic
918078412 1:181188077-181188099 CCTGAGAAACAGAACAAACTGGG + Intergenic
918536733 1:185583066-185583088 CTGGAGAAAAAGAGCACACAGGG + Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919923880 1:202182188-202182210 CCAGAGAAACAGAACAAACAGGG + Intergenic
920098755 1:203503420-203503442 CTGGAGAAACTGAAGCATCTAGG - Intronic
921279798 1:213555235-213555257 CTGAAGAATCAGAACAAACTAGG + Intergenic
922078742 1:222273748-222273770 CCAGAAAAACAGAACCAATAGGG + Intergenic
922345792 1:224695396-224695418 CCAGTAAAACAGAACCAACAGGG - Intronic
922528480 1:226324907-226324929 CTAGAGAGAGAGAACCAACAGGG + Intergenic
923134317 1:231104678-231104700 CTAGAGAAACAGAACCAATAGGG + Intergenic
923398746 1:233594128-233594150 CCAGAGAAACAGAACAAATAGGG + Intergenic
923828293 1:237524666-237524688 TGAGATAAACAGAACCAACAGGG + Intronic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
924495221 1:244582277-244582299 CTGGAGGAAGACAACCAACATGG + Intronic
924516766 1:244772722-244772744 CCAGAGAAACAGAACTAATAGGG + Intergenic
924608065 1:245552101-245552123 CCAGAGAAACAGAACCAGCAGGG + Intronic
1062989779 10:1804570-1804592 CTGTAGCCACAGAAACAACAGGG + Intergenic
1063309456 10:4938544-4938566 CAGGAGAAACAGAATCCTCATGG + Intronic
1063473402 10:6307372-6307394 CCAGAGAAACAGAACCAGTAGGG - Intergenic
1065848384 10:29765397-29765419 TTGGAGAAAAAAATCCAACAGGG + Intergenic
1065943034 10:30582313-30582335 CTCAAGAAACAGCAGCAACAAGG + Intergenic
1067034386 10:42902082-42902104 CCAGAGAAACAGAACCACTAAGG + Intergenic
1068956730 10:62825058-62825080 CAGGAGAAGCAGACCCACCAAGG - Intronic
1069297821 10:66868936-66868958 CTGGAGAAAATGAAACACCATGG + Intronic
1069374256 10:67777773-67777795 CTCCAGAGACAGAACCAAAAAGG - Intergenic
1070997685 10:80800288-80800310 CCAAAGAAACAGAACCAATAGGG - Intergenic
1071759107 10:88580251-88580273 CCAGAGAAACAGAACCAATAGGG - Intronic
1071881669 10:89905576-89905598 CAACAGGAACAGAACCAACAGGG - Intergenic
1071898697 10:90094434-90094456 CAAGAGAAACAGAAACAATAGGG + Intergenic
1072150490 10:92679025-92679047 CTAGAGAAACAGAAGCTTCATGG - Intergenic
1072464266 10:95648716-95648738 CTGGAGAATGAGAAGCCACAGGG + Intronic
1072694777 10:97595074-97595096 CTGGGGACACATAAGCAACATGG - Intronic
1072997535 10:100258854-100258876 CTAGAGAAATAAGACCAACAAGG + Intronic
1073255112 10:102146039-102146061 CTGAAGAAACAAAACCAACTGGG + Intronic
1073774704 10:106772513-106772535 CCAAAGAAACAGAACCAATAAGG - Intronic
1074498021 10:113996936-113996958 GTGGAGTGAGAGAACCAACATGG - Intergenic
1075559002 10:123454919-123454941 CCAGAGAAATAGAACCAATAGGG + Intergenic
1075573752 10:123563541-123563563 CTGGGAAAACAGACCCAACAAGG - Intergenic
1075646526 10:124100432-124100454 CCAGAGAAACAGAACCAATAAGG + Intergenic
1075956565 10:126528411-126528433 CTTGAAAAACAGGTCCAACAGGG + Intronic
1076012395 10:127000735-127000757 GCGGAGAAACAGCACCAACATGG - Intronic
1076012409 10:127000823-127000845 GCGGAGAAAGAGCACCAACATGG - Intronic
1076012418 10:127000889-127000911 GTGGAGGAAGAGCACCAACATGG - Intronic
1076228528 10:128800586-128800608 CCAGAGAAACAGAATCAATAGGG + Intergenic
1076476163 10:130753036-130753058 CCAGAGAAACAGAACCAATAGGG + Intergenic
1076591474 10:131586729-131586751 TCAGAGGAACAGAACCAACAGGG - Intergenic
1076940079 10:133599087-133599109 CCAGAGAAACAGAACCAATAGGG - Intergenic
1077381573 11:2243902-2243924 CCAGAGAAACAGAACCAACAGGG + Intergenic
1078564915 11:12406086-12406108 CCAGAGAAACAGAACCAGTAGGG + Intronic
1079845834 11:25466616-25466638 CAGCAAAAACAGAACCAAGAGGG + Intergenic
1079871059 11:25798461-25798483 CCAGAGGAACAGAACCAATAGGG + Intergenic
1080041872 11:27767723-27767745 CTAGAGAGACAGAACTAATAGGG + Intergenic
1080043775 11:27786956-27786978 ATGGAGAATGAGAACCCACAGGG + Intergenic
1080254916 11:30279969-30279991 CCTGAGAAACAGAATCCACAGGG + Intergenic
1080364360 11:31553765-31553787 CTAGAGAAACTGAACCAATAGGG - Intronic
1080392306 11:31859789-31859811 CTGGAGATAGTGAATCAACATGG - Intronic
1081262283 11:40975364-40975386 CCAGAGAGACAGAACCAATAGGG - Intronic
1081386636 11:42480305-42480327 CTGCAGAAACAGAGCCCTCATGG + Intergenic
1081482598 11:43503607-43503629 CCAGAGAAGCAGAACCAATAGGG + Intergenic
1081723753 11:45310398-45310420 AGAGAGAGACAGAACCAACATGG - Intergenic
1083704258 11:64502643-64502665 CCAGAGAAACAGAACCAACATGG + Intergenic
1084012911 11:66362642-66362664 CAGGAAGAACAGCACCAACAGGG + Exonic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084478008 11:69399893-69399915 CCAGAGAAACAGAATCAATAGGG + Intergenic
1084486903 11:69453486-69453508 CCAGAGAAACAGAACCCAGAGGG + Intergenic
1084587604 11:70072141-70072163 CTGGGGAATCAGAACCTTCAAGG - Intergenic
1084733261 11:71088337-71088359 CCAGAAAAACAGAACCAATAGGG - Intronic
1084841356 11:71853013-71853035 CTGCAGAAACCAAAACAACATGG + Intergenic
1085016051 11:73174702-73174724 CTGGATAATCAGAACCAAAGGGG + Intergenic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1086239001 11:84666511-84666533 CCAGAGAAACAGAACCAATATGG - Intronic
1087013084 11:93531564-93531586 GCAGAGAAACAGAACCAATAGGG - Intronic
1087368268 11:97248839-97248861 CTGCAGAAAGGGAACCCACAAGG - Intergenic
1087856967 11:103103848-103103870 CCAGAGAAACAGAATCAACAGGG + Intergenic
1088532092 11:110821406-110821428 CCAGAGGAACAGAACCAATAAGG - Intergenic
1088683968 11:112269534-112269556 CTGCAACAACAGAACCAACACGG - Intronic
1089421418 11:118333868-118333890 CTAGAGAAACAGAACCAATAGGG + Intergenic
1089649401 11:119902684-119902706 CCAGAGAAACAGAACCGATAGGG + Intergenic
1090369088 11:126234743-126234765 CTTCAGAAACAGAAGCAAGATGG + Intronic
1091853785 12:3722634-3722656 CAGGACACACAGTACCAACAGGG + Intronic
1092027953 12:5258829-5258851 CTAGAGAAACAGAACTAACAGGG - Intergenic
1092316000 12:7414022-7414044 ATGGAAAAACAGAAACACCAAGG + Intronic
1093769821 12:23005318-23005340 CTAGAGAAACAAAACAAATAAGG + Intergenic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093927654 12:24925493-24925515 CCAGGGAAACAGAACCAATAGGG - Intronic
1094309415 12:29062121-29062143 CAGGAGATATAGACCCAACATGG - Intergenic
1095345866 12:41148149-41148171 CTGCAGAAGCAGAACCCTCATGG - Intergenic
1095541678 12:43316361-43316383 CAGGATAAACAAAACCAATATGG + Intergenic
1096983527 12:55742713-55742735 TGGGAGACACAGAACCAAGAAGG - Intergenic
1097767171 12:63539393-63539415 CCAGAGAAACAGAACCAACAGGG + Intergenic
1097783518 12:63734339-63734361 CCAGAGAAACAGAACCAACAGGG + Intergenic
1098223925 12:68301242-68301264 CTAGAGAAACAGGAACACCACGG + Intronic
1098875942 12:75866791-75866813 CCAGAGAAACAGAACGAATATGG - Intergenic
1098946107 12:76591566-76591588 CTGCAGAAACAGTGCCAACTTGG + Intergenic
1098992175 12:77075863-77075885 CCAGAGAAACAGAACCAATAGGG - Intergenic
1099889611 12:88574670-88574692 ATGGAGAAAGAAAACCAAGAAGG - Intronic
1099949770 12:89288732-89288754 CCAGAGAAAGAGAACCAATAAGG + Intergenic
1100008601 12:89924946-89924968 CTGCTGATATAGAACCAACAAGG - Intergenic
1100034699 12:90236408-90236430 CCAAAGAAACAGAACCAATAGGG - Intergenic
1101403554 12:104408912-104408934 CCAGAGAGACAGAACCAACAGGG + Intergenic
1102714399 12:114957295-114957317 CCAGAGAAACAGACCCAATAGGG - Intergenic
1103124774 12:118411863-118411885 CTAGAGAAACAAAACCAAGATGG - Intronic
1103425689 12:120831329-120831351 CCAGAGAAATAGAACCAATAGGG - Intronic
1104181674 12:126387747-126387769 CTAGAGAAGCAGAACCAATAGGG + Intergenic
1104263312 12:127205581-127205603 AAGGAGAAACAGAACCAATAGGG + Intergenic
1104325950 12:127798609-127798631 CTAAAGCAACAGAACCAAAAAGG - Intergenic
1105624977 13:22103956-22103978 CTGCAGCTACAGCACCAACAGGG + Intergenic
1106066518 13:26357621-26357643 CCAGAGATGCAGAACCAACAAGG + Intronic
1106679490 13:31995503-31995525 CTGCAGAAATAGAACCCTCAAGG - Intergenic
1107060148 13:36151712-36151734 CTGAAGAAAGAGAAACCACATGG + Intergenic
1107324756 13:39229929-39229951 CCAGAGAAACAGAACTAATAGGG - Intergenic
1107637862 13:42411126-42411148 CCAGAGAAACAGAACCAATATGG + Intergenic
1108706411 13:52992398-52992420 CTTGTAAAACAGAAGCAACAGGG - Intergenic
1109615836 13:64832779-64832801 CTGCAGTAACAAAATCAACATGG + Intergenic
1109910374 13:68903505-68903527 CTGCAGAAACAAAAACAGCATGG - Intergenic
1111317208 13:86578204-86578226 GTGGAGAAACAGAAAAAAAAAGG - Intergenic
1111556372 13:89886457-89886479 ATGCAGAGACAGAACCAAAAAGG - Intergenic
1111559254 13:89923572-89923594 CCAGAGAATCAGAACCAACACGG - Intergenic
1111571033 13:90086795-90086817 CTGGAGAACTAGAAACACCAGGG - Intergenic
1111667679 13:91290344-91290366 CTGGAGATGTAGAACCAACAGGG - Intergenic
1112076243 13:95916250-95916272 CAGGAAAAACAGAAGCAACTAGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113134159 13:107071024-107071046 CCAGGGAAACAGAACCAACAGGG + Intergenic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1113328603 13:109307641-109307663 ATGGAGAAATAGAATCTACAAGG + Intergenic
1113574645 13:111386418-111386440 CCAGAGAAACAGAGCCAATAGGG + Intergenic
1114158701 14:20137295-20137317 CTCAAAAAACAGAACCATCATGG + Intergenic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1115471859 14:33776212-33776234 CTGGAGAAGGAGATCCAACCAGG + Intronic
1115925829 14:38433027-38433049 CTGAACAAACAAAACCAACTAGG + Intergenic
1116688948 14:48080334-48080356 CCAGAGAAACAGAACAAATAGGG - Intergenic
1117145417 14:52832574-52832596 GGAGAGAAACAGAACCAATAGGG - Intergenic
1117434630 14:55704142-55704164 CCAGAGAAATAGAACCAATAGGG - Intergenic
1117560554 14:56933613-56933635 CCAGAGAAACAGAATCAATAAGG + Intergenic
1118012178 14:61621251-61621273 CCAGAGAAACAGAACCAATAGGG - Intronic
1118416366 14:65541248-65541270 CTAGAGAAACAGTACCAATAGGG + Intronic
1118496297 14:66311119-66311141 CTTGAGAAAAAGAACCAGGAAGG + Intergenic
1118722235 14:68602430-68602452 CCAGAGAAACAGAACCAACAGGG + Intronic
1119872051 14:78026425-78026447 TCAGAGAAACAGAACCAACAGGG - Intergenic
1119890196 14:78176814-78176836 CTGAAGAAAGAGAACTAAGAAGG - Intergenic
1120016642 14:79481622-79481644 GTGGACAAACAGAACCCACTGGG - Intronic
1120540960 14:85750196-85750218 CTGGCAAACTAGAACCAACATGG - Intergenic
1120596353 14:86442175-86442197 CTAGAGAGACAGAACTAATAGGG + Intergenic
1120656963 14:87201927-87201949 TCTGAGACACAGAACCAACATGG + Intergenic
1120724387 14:87921675-87921697 CAGAGAAAACAGAACCAACAGGG + Intronic
1121489808 14:94349709-94349731 CTGGAGGAACAGAACCTGCCGGG + Intergenic
1121539696 14:94716013-94716035 CCAGAGAAACAGAACCAACAAGG + Intergenic
1121555082 14:94830336-94830358 CCAGAGAAACAGAGCCAACAGGG - Intergenic
1122030968 14:98911602-98911624 CTAGAGAAAGAAAACCAACATGG - Intergenic
1122385341 14:101341543-101341565 CCAGAGAAACAGAACCACCAGGG - Intergenic
1123726915 15:23112347-23112369 CTGGAGCAACACAACAAGCAGGG + Intergenic
1123936814 15:25198063-25198085 CTGGAGAAACTGTCCCAACCTGG - Intergenic
1124401737 15:29354399-29354421 CCAGAGAAACAGAACCAATGGGG - Intronic
1124728872 15:32179708-32179730 CGGGAGCCAGAGAACCAACAAGG - Intergenic
1126410122 15:48364834-48364856 CTGGAGAGGCTGAACCAGCAGGG - Intergenic
1126694583 15:51315171-51315193 GTTGAGAAACACAACCAGCAAGG - Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1129190618 15:73935516-73935538 CTGGAGTAACTGAAGCATCAAGG + Intronic
1130027681 15:80283832-80283854 CCAGAGAAAGAGAACCAATAGGG - Intergenic
1131138513 15:89958223-89958245 CTGGAACAACAGGGCCAACAGGG - Intergenic
1133164047 16:3934068-3934090 GTGGAGAAACAGTAATAACATGG + Intergenic
1133709132 16:8384395-8384417 CCAGAGAAACAGAACCAATAGGG - Intergenic
1134181956 16:12055077-12055099 CTAGAGAAACAGAACCAGTGTGG + Intronic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1136929269 16:34404473-34404495 CTGGAGACGCAAAACCTACAGGG + Intergenic
1136975305 16:35007331-35007353 CTGGAGACGCAAAACCTACAGGG - Intergenic
1138187994 16:54991385-54991407 CCAGAGAAACAGAATCAATAGGG + Intergenic
1138973520 16:62174674-62174696 CCAGAAAAACAGAACCAATAGGG - Intergenic
1139551649 16:67676450-67676472 CCAGAGAAACAGAACCAATAGGG - Intronic
1140157686 16:72449922-72449944 CTGTAGTAACAAAAACAACATGG - Intergenic
1140361569 16:74348883-74348905 CTGGAGATTCAGAATCTACAGGG - Intergenic
1140593150 16:76376883-76376905 CCAGAGAAACAAAACTAACAAGG + Intronic
1142613589 17:1122782-1122804 CTAGAGAAACAAAACCAACAGGG - Intronic
1143129125 17:4665033-4665055 CTAGGGAAGCAGAAGCAACAAGG + Intergenic
1143763369 17:9120973-9120995 CTGGAGACAGAAAACCATCAGGG + Intronic
1143904206 17:10196927-10196949 CTCCAGATACAGAACCAAGAGGG + Intronic
1144188947 17:12825386-12825408 TTAGAGAAACAGAACCAATAAGG + Intronic
1144346882 17:14357464-14357486 CCAGAAAAACAGAAACAACAGGG + Intergenic
1146081985 17:29788693-29788715 TTAGAGAAATAGAACCAAAAAGG - Intronic
1146556892 17:33832885-33832907 GTGGAGACTTAGAACCAACACGG + Intronic
1148379078 17:47179234-47179256 TTGGAGAAAGACATCCAACAAGG - Intronic
1148654337 17:49272052-49272074 CCAGAGAAACAGAACCAGTAGGG + Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148844154 17:50518922-50518944 CTGCCGAACCAGAACAAACAGGG - Intronic
1149408553 17:56380291-56380313 CTTTAGAAACAGAGCCAAGATGG + Intronic
1151020201 17:70606469-70606491 GTGGGAAAACAGAACCAACCTGG - Intergenic
1151147857 17:72058063-72058085 CCGGAGAAATTGAACCGACAAGG + Intergenic
1152026683 17:77814201-77814223 CTGGAGGATGAGAAGCAACATGG + Intergenic
1152057459 17:78041149-78041171 CAGGAGAAACGGAACAAACACGG + Intronic
1152264743 17:79287733-79287755 CTGGAGGGACAGAGCCCACAGGG + Intronic
1153541263 18:6158688-6158710 CTGTAGAAAGAGATCCCACATGG + Intronic
1153584583 18:6608089-6608111 CCAGAGAAACAGAACCAATAAGG + Intergenic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1155076627 18:22362952-22362974 CAGGTGAAAAGGAACCAACAAGG - Intergenic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1157939334 18:51909827-51909849 CTAGAGAAACAAAACCAATAGGG - Intergenic
1158212128 18:55063476-55063498 CCAGAGAAACAGAACCAATGGGG - Intergenic
1159169953 18:64753292-64753314 CCAAAGAAACAGAACCAATAGGG - Intergenic
1159430975 18:68352984-68353006 CTGCAGAAACAAAGCCAAGAGGG - Intergenic
1159651875 18:70987391-70987413 ATGGAGTAACACAACCACCATGG + Intergenic
1160007349 18:75077021-75077043 CTGGAGAAATCCAACCAGCAAGG + Intergenic
1160223294 18:76992660-76992682 TTCGGGAAACAGAAGCAACATGG + Intronic
1160616136 18:80130683-80130705 CAGGAGAGAGAGAAACAACAAGG - Intronic
1161836057 19:6647435-6647457 CCAGAGAAACAGAACCAAGGAGG - Intergenic
1164299849 19:23952261-23952283 CTAAAGAAACTGGACCAACAGGG - Intergenic
1164566530 19:29329741-29329763 CTGGGGAAACAGAGCCAAGCTGG + Intergenic
1164704281 19:30308520-30308542 CTGGAGCAACAAAACCAAGATGG - Intronic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1165828320 19:38718169-38718191 CCTGAGAAACAGACCCAACGTGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168431747 19:56287102-56287124 CAGGAGTAACAGAAACCACAAGG - Intronic
925050184 2:807390-807412 CTGGAGAAACCAAGCTAACAAGG - Intergenic
925818883 2:7779586-7779608 TTAGAGAAACAGAACCAGTAGGG - Intergenic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
926607643 2:14913691-14913713 CAGGGGAAACAGAACCAGCTTGG + Intergenic
926625633 2:15087259-15087281 TCAGAGAAACAGAACCAATATGG - Intergenic
926781133 2:16472956-16472978 CCAGAGAAACACAACTAACAGGG - Intergenic
926816290 2:16801003-16801025 CTGGAGACACAGAAACACAAAGG + Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927425184 2:22973574-22973596 CTAGAGGAACAGAACTAATAGGG - Intergenic
927740062 2:25560734-25560756 CTAGAGAAACAGACTCAATAGGG - Intronic
928207469 2:29296395-29296417 GGGGAGAAACAGAATCAAAACGG - Intronic
928222493 2:29416143-29416165 CCAGAGAAACAGAACCAGGAGGG - Intronic
928293159 2:30057772-30057794 TTGGTGTAACAGAACCAAAAAGG + Intergenic
928407496 2:31025704-31025726 CCAGAGAAACAGAACCAACAGGG + Intronic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
929774392 2:44919378-44919400 CTGCAGAAACAAAAGCCACAGGG - Intergenic
929821231 2:45275459-45275481 CCAGAGAAACAGAACCAACAAGG - Intergenic
930003397 2:46877232-46877254 ATGGAGAGACAGAAGCCACATGG - Intergenic
930623631 2:53670691-53670713 CTGGAGAAACAAAAAAAGCAAGG + Intronic
931660627 2:64559244-64559266 CCAGATAAACAGAACCAATAGGG + Intronic
932523604 2:72440235-72440257 CTGGAGAACCAAAGCCAACTGGG - Intronic
933829121 2:86192250-86192272 CCAGAGAAACAGAAACAATAAGG - Intronic
935209385 2:100925371-100925393 CTGGGGAGACAAAACCAACCAGG - Intronic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
935498262 2:103807714-103807736 CCAGAGAAACACAACCAACAGGG + Intergenic
935884921 2:107607204-107607226 ACAGAGAAACAGAACTAACAGGG - Intergenic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
936542947 2:113366883-113366905 CTGCAGAACCACATCCAACATGG + Intergenic
936897369 2:117443924-117443946 CTAGAGAAACAGAGCCAAACAGG + Intergenic
938966680 2:136394778-136394800 CTGGAGGAACAGAAAGTACAGGG + Intergenic
938982525 2:136540054-136540076 CTAGAGAAACAGAACCAATAGGG + Intergenic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
939754919 2:146098577-146098599 CTAGAAAAACATAACCAAAAGGG - Intergenic
939817039 2:146909098-146909120 CTAGATAAACAAAACCAAGATGG + Intergenic
939817530 2:146914549-146914571 CTAGAGAAACAGAACCAGTAGGG - Intergenic
940243324 2:151587040-151587062 CTAGAGAAACAGAACCAATAGGG - Intronic
940244280 2:151597593-151597615 CTAGAGAAACAGAACCAATAGGG - Intronic
940245236 2:151608139-151608161 CTAGAGAAACAGAACCAATAGGG - Intronic
940548724 2:155124125-155124147 CCAGAGAAACAGAACCAATTCGG - Intergenic
941802191 2:169672334-169672356 CCAGAGAAACAGAACCAAGAGGG + Intronic
941966779 2:171308640-171308662 CTAGAGAGATAGAACCAATAGGG + Intergenic
942899512 2:181097056-181097078 CCAGAGAAACAGAACCAATAGGG + Intergenic
943176734 2:184485453-184485475 ATGCAGAATCATAACCAACAAGG + Intergenic
943244924 2:185434662-185434684 CCAGAGAAACAGAACCATTAAGG + Intergenic
943265998 2:185733749-185733771 CAAGCAAAACAGAACCAACAGGG - Intergenic
943513538 2:188856525-188856547 CTAGAGAGACAGAACTAATAGGG + Intergenic
944572553 2:201059260-201059282 CCAGAGAAACAGAACCAATAAGG - Intronic
945599814 2:211846834-211846856 CTGGAGAAATATAACTAAGATGG - Intronic
945974329 2:216258879-216258901 CAGGAGAAACAAAACCAAACAGG + Exonic
946113620 2:217442569-217442591 CCAGAGAAACAGAACCAATATGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946642042 2:221794430-221794452 CTGGAGATACTGAACCTAGATGG - Intergenic
947082154 2:226410746-226410768 CCAGAGAAACAGAACCAATGTGG - Intergenic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
947348990 2:229222906-229222928 CCAGAGAAACAGAACCAATAGGG - Intronic
947436849 2:230080306-230080328 CTGGAGAAACTGAACCAGAGAGG + Intergenic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947943383 2:234078038-234078060 CTGGAGGAAAAGCAGCAACAAGG - Intergenic
1168937319 20:1676667-1676689 CTAGACAAAGAGAAACAACACGG - Intergenic
1171045505 20:21806462-21806484 CCAGAGAAACAGAATCAATAGGG + Intergenic
1171379891 20:24726720-24726742 CCAGGGAAACAGAACCAATATGG + Intergenic
1172582739 20:36061272-36061294 CCAGAGAAAGAGAACCAATACGG - Intergenic
1173047837 20:39529497-39529519 CAGGAGGGACAGAACTAACAAGG + Intergenic
1173312841 20:41916070-41916092 CAGAAGAAACAGCCCCAACAAGG - Intergenic
1174080961 20:47970496-47970518 CTGGAGCAGCAAGACCAACAGGG - Intergenic
1174307268 20:49622451-49622473 GAGGAAAATCAGAACCAACATGG - Intergenic
1174420391 20:50395601-50395623 CTGGAGAAGCAGAACCACCCTGG - Intergenic
1174733895 20:52945647-52945669 TCAGAGAAACAGAGCCAACAGGG + Intergenic
1175480236 20:59305455-59305477 CTAGAGAGACAGAACCAACAGGG + Intronic
1176083940 20:63287406-63287428 CGGGAGAAACAGATCCCACCTGG + Intronic
1176273343 20:64247843-64247865 CCAGAGAAACAGAACCAATAGGG + Intergenic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1176916590 21:14633235-14633257 CTAGAGAAACAGAAGTAATAGGG - Intronic
1177053579 21:16270747-16270769 CTGGACAAGGAGAGCCAACACGG - Intergenic
1177972285 21:27805428-27805450 CCAGAGAAACAGGACCAATAGGG + Intergenic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1178111027 21:29370346-29370368 CCAGAGAAACAGAACCAATAAGG - Intronic
1178199152 21:30383207-30383229 CCAAAGAAACAGAACCAATAGGG + Intronic
1178511940 21:33212711-33212733 CCAGAGAAACAGAACCAATGAGG + Intergenic
1178549938 21:33528336-33528358 CTGGAAAAACATAATCCACATGG + Intronic
1179143511 21:38748139-38748161 ATGGAGAAGCAGAACCCACCAGG - Intergenic
1180005950 21:45020649-45020671 CTGAAGAAACCAAACCAAGATGG + Intergenic
1180571620 22:16727654-16727676 CTGGAAAACCCAAACCAACATGG - Intergenic
1181685722 22:24526581-24526603 CTAGAGAAGCAGAACCAGTAGGG - Exonic
1184625699 22:45726979-45727001 CTAGAGAAACAGAACCAACTAGG - Intronic
1185114490 22:48923931-48923953 CCAGAGAAACAGAATAAACAGGG - Intergenic
1185114493 22:48923950-48923972 CTGGAGAAACATAACTAATACGG + Intergenic
1185200459 22:49499892-49499914 CCAGAGAAACAGAACCAGTAGGG + Intronic
1185302827 22:50091418-50091440 CTGGAGAATCTCAACAAACACGG - Intronic
949203267 3:1406621-1406643 CCAGAGAAACAGAGCCAATAGGG + Intergenic
949465828 3:4342793-4342815 CTGCAGTCACAGAACCATCAAGG + Intronic
949607458 3:5670014-5670036 CCAAAGGAACAGAACCAACAGGG + Intergenic
949624593 3:5852130-5852152 GGGGAGATACAGAACCACCATGG + Intergenic
950887758 3:16375818-16375840 CTGGAGAAACAGACCCTGCTGGG - Intronic
951387523 3:22060293-22060315 TTAGAGAAACAGAACCAATAGGG - Intronic
951539092 3:23765433-23765455 CTAGAGACACTGAACGAACAGGG + Intergenic
951633417 3:24745908-24745930 CTAGAGAAATAGAACAAATAGGG - Intergenic
951692913 3:25416067-25416089 CTGAAGAAAAAGATGCAACAAGG + Intronic
952243177 3:31555500-31555522 CAGGAGTAACAGAACTATCAAGG - Intronic
952782341 3:37113775-37113797 CAGGAGGAAAACAACCAACATGG + Intronic
953118121 3:40012918-40012940 CCAGAGAAACTGAACCAATAGGG - Intronic
953208855 3:40856623-40856645 CCAGAGAAACACAACCAATAGGG - Intergenic
953959749 3:47257678-47257700 CTGGGGGAAGGGAACCAACATGG - Intronic
954638257 3:52083322-52083344 GTGGCGAAACAGAGCAAACAAGG + Intronic
954899202 3:54004563-54004585 CCAGGGAAACAGAATCAACAGGG + Intergenic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
955397390 3:58566787-58566809 GTGGGGAAACAGAACCAACCTGG + Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956626127 3:71268550-71268572 TTTGAGAAAAACAACCAACATGG + Intronic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
958157132 3:89769866-89769888 CTAGAGTAACACAAGCAACATGG + Intergenic
958427130 3:93991863-93991885 CTGAATAAACATAACTAACAAGG - Intronic
958959826 3:100498598-100498620 CCAGAGAAACAAAACCAACAGGG - Intronic
959085346 3:101846762-101846784 CCAGAGAAACAGAACCAATAGGG + Intronic
959135344 3:102411830-102411852 CCAGAAAAACAGAACCAATAGGG + Intronic
959633224 3:108532652-108532674 GCAGAGAAACAGAACCAATAGGG - Intergenic
960372110 3:116853217-116853239 CCAGAGAAACAGAACCAATAGGG - Intronic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
963007794 3:140742023-140742045 CAAGAGAAACAGAAGCAATAGGG + Intergenic
963344596 3:144079535-144079557 CCAGAGAAACAGAACCAACAGGG - Intergenic
963534109 3:146506568-146506590 CCAGAGAAAGAGAACCAATAGGG + Intergenic
963666603 3:148196026-148196048 AGCGAGAAACAGGACCAACAAGG + Intergenic
964413994 3:156428534-156428556 CCAGAGAAACAGAACCAATAGGG - Intronic
965014320 3:163137112-163137134 CTGAAGAAAAAGAACAAACCTGG - Intergenic
965029738 3:163350460-163350482 CCAGAGAAATAGAACCAATATGG - Intergenic
965173950 3:165305874-165305896 ATGCAGAAGCAGTACCAACAGGG + Intergenic
965246596 3:166279416-166279438 CCAGAGAAACAGAACCAGTAGGG - Intergenic
965373696 3:167895583-167895605 CTGTAGAAAAAGAAGCAAAATGG - Intergenic
966394126 3:179484293-179484315 CTGGAGGAACAGAACCCGAAGGG - Intergenic
966495327 3:180573620-180573642 CCAGAGAAACAGAACCAATAGGG - Intergenic
967125258 3:186417754-186417776 CTGGAGTAACAGTAACAACATGG - Intergenic
967377197 3:188817793-188817815 GTGGAGAAACAGATACTACAGGG + Intronic
967640161 3:191853066-191853088 CTTTAGAGAGAGAACCAACAGGG - Intergenic
967943244 3:194782532-194782554 CCAGAAAAACAGAACCAATAGGG - Intergenic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
968223112 3:196953156-196953178 CCAGAGAAACAGAAACAATAGGG - Intronic
968691962 4:1995298-1995320 CCAGAGAAACAGAACCAAGAGGG - Intronic
969149782 4:5159422-5159444 CTAGTGAAACAGAACCAATGGGG + Intronic
969390332 4:6888099-6888121 CTGGAGCTGCAGATCCAACAAGG - Intergenic
971808025 4:31385639-31385661 CCAGAGAAACAGAACCAACAGGG - Intergenic
971876276 4:32312957-32312979 CTAGAGAAAGAGAACCAGCAGGG - Intergenic
972686428 4:41358148-41358170 CAGGAGAAAGAGAACAAAGAGGG + Intergenic
973594885 4:52478035-52478057 CCAGAGAAACAGAACCAACAGGG + Intergenic
973694256 4:53474621-53474643 CTGTAGTAACAGAATAAACATGG - Intronic
974529968 4:63096205-63096227 CCAGAGAAACAGAACCAAGAGGG + Intergenic
974574028 4:63693478-63693500 CCAGAGAAACAGAATCCACAGGG + Intergenic
974831357 4:67193330-67193352 CAAGAGGAACCGAACCAACAAGG + Intergenic
974883326 4:67786141-67786163 CTAGAGAAATAGAACCAGCCAGG + Intergenic
975086245 4:70343269-70343291 CCAGAGAAACAGAACCAAATGGG + Intergenic
975177446 4:71304148-71304170 CCAGAGAAACAGAACCAAGAGGG + Intronic
975320211 4:73001633-73001655 CTGGAGAAAGAAAACTAACTAGG - Intergenic
975396477 4:73879896-73879918 CTGCAGAAACCAAAACAACATGG - Intergenic
975544384 4:75546572-75546594 CTAGAGAAACAGAACCAATAGGG + Intronic
975703719 4:77091071-77091093 CCTGAGAAACATAGCCAACAGGG + Intergenic
976396090 4:84557279-84557301 CCAGAGAAACAGAACAAATAGGG - Intergenic
976576904 4:86683121-86683143 GCAGAGAAACAGAACCAATAGGG + Intronic
976775406 4:88700666-88700688 CCAGAGAAACAGAACCAACAGGG + Intronic
977050141 4:92119382-92119404 CTGCAGAAGCAGAACCCTCATGG + Intergenic
977283515 4:95071889-95071911 CCAGAGAAACAGAGCCAATAAGG + Intronic
978038477 4:104027160-104027182 CTGGAGAAACTGAACTTAAAAGG + Intergenic
978330511 4:107608125-107608147 CTGCAGAAATACAACCAAAAAGG + Intronic
978429344 4:108617417-108617439 CTAGAGAAACAGAACTGATAGGG - Intergenic
978483845 4:109227766-109227788 CTCCAGAGACAGAACCAATAGGG + Intronic
979438647 4:120724844-120724866 CAGGTGAAACAAAACCATCAAGG + Intronic
980101311 4:128543897-128543919 GTGCTGAAGCAGAACCAACATGG - Intergenic
981041874 4:140230630-140230652 CCAGAGAAATAGAACCAATAGGG + Intergenic
983974323 4:173914655-173914677 CTAGAGAAATAGAAACAAAATGG + Intergenic
985103343 4:186479175-186479197 CTTGAGAAACTGACTCAACAGGG + Intronic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
986120552 5:4831814-4831836 CAGGAAAAACAGAAACTACAAGG - Intergenic
986749158 5:10770656-10770678 CCAGAGAAACAGAACCAACAGGG - Intergenic
987154250 5:15071966-15071988 CCAGAGAATCAGAATCAACAGGG - Intergenic
987305230 5:16631232-16631254 CCAGAGAAACAGAACCAATAGGG + Intergenic
987578008 5:19755405-19755427 CTAGAGGGACAGAACTAACAGGG + Intronic
988102695 5:26702358-26702380 CTAGAGGGACAGAACAAACAGGG - Intergenic
988980111 5:36559687-36559709 CCAGAGAAATAGAACCAATAGGG - Intergenic
989497359 5:42124726-42124748 CAGGAGAGAGAGAACCAAGAGGG + Intergenic
990054491 5:51554581-51554603 CCAGAGAAACAGAACAAACAGGG - Intergenic
990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG + Intergenic
990605101 5:57401395-57401417 CTGGAGTAACAAAAACAGCATGG - Intergenic
990766079 5:59184201-59184223 CTGGAAAAACAGAACCTAATGGG + Intronic
991538744 5:67703564-67703586 CTGAAGAAAAAGAACAAACTTGG + Intergenic
992070043 5:73139876-73139898 CCTGAGAAACAAAACCAATACGG - Intergenic
992321477 5:75617305-75617327 TTGGAAAAACAGAACCACAAAGG - Intronic
992504994 5:77378051-77378073 CTCTAGACAAAGAACCAACAGGG - Intronic
992716810 5:79519405-79519427 CTAGAGAAATAGAACCAATAGGG + Intergenic
993111103 5:83658320-83658342 CTGGAGAAACAACATAAACAAGG - Intronic
993299606 5:86191754-86191776 CCAGAGAAACAGAGCCAATAGGG - Intergenic
993367623 5:87052545-87052567 CTGAAGTAACAAAACCAGCATGG + Intergenic
994168155 5:96629449-96629471 TGGGAGAAACTGAACCAAAATGG - Intronic
995174038 5:109153160-109153182 CTTGAGAAATAGCACCACCATGG - Intronic
996468307 5:123829240-123829262 CTAGAGGAACAGAACTAATAGGG + Intergenic
997294678 5:132762096-132762118 CTGGAGAATCAGGAGCACCAGGG - Intronic
997527660 5:134563782-134563804 TGGCAGAGACAGAACCAACAGGG + Intronic
997846495 5:137291221-137291243 CTGGAGGAGCAGAGCCACCAGGG + Intronic
997874183 5:137533892-137533914 CCAGAGAAACAGAACTAATAGGG - Intronic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
998494729 5:142578176-142578198 CCAGAGAACCAGAACCAATAGGG + Intergenic
999490277 5:152043506-152043528 CCAGAGAAACTGAACCAATAGGG - Intergenic
1000299238 5:159940416-159940438 CTGGCTAAACCGAACTAACAGGG - Intronic
1000440786 5:161260632-161260654 CTGGGGAAACAGAATAAAAATGG + Intergenic
1000550487 5:162656569-162656591 GTGGAGAAACAAAACAGACATGG - Intergenic
1001676157 5:173518055-173518077 CCAGAGAAAGAGAACCAATAGGG + Intergenic
1001783021 5:174386805-174386827 CCAGAGAAACACAACCAACAGGG - Intergenic
1002346101 5:178548084-178548106 CCAGAGAAACAGAACCAATAGGG - Intronic
1002583590 5:180226513-180226535 CTGGGGAAGCAGTTCCAACAGGG - Intergenic
1002836934 6:872919-872941 CTGGAGAAACAGCCCCACCCTGG + Intergenic
1003149206 6:3534564-3534586 CCAGAGAAACAGAACTAATAAGG - Intergenic
1003338095 6:5194041-5194063 CCAGAGAAACAGAACCAACAGGG + Intronic
1003520161 6:6851490-6851512 CTGGAGAAAAAGAGACAACAGGG + Intergenic
1003658370 6:8036211-8036233 CAGCAAAAACAGTACCAACAGGG + Intronic
1003757946 6:9143312-9143334 CCAGAGAAACAGGACCAACAGGG - Intergenic
1004184774 6:13412623-13412645 CTGGAGTAACAGTAACAACGGGG - Intronic
1004192596 6:13477193-13477215 CCAGAGAAACAGAACCAATAGGG + Intronic
1004653793 6:17638382-17638404 CTGGAGAAACAGATCACAGATGG - Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1005201630 6:23351697-23351719 CTTAAGAAAGAGAACCAAGAAGG - Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1005506216 6:26470964-26470986 CCAGAGAGACAGAACCAATAGGG - Intronic
1005835715 6:29707428-29707450 ACAGAGAAACAGAACCAATAAGG - Intergenic
1005885080 6:30091465-30091487 GTGGAGAAACAAAAAGAACAAGG + Intergenic
1006015600 6:31078391-31078413 CTGGAGAAACTGACCAGACAAGG + Intergenic
1007643130 6:43358929-43358951 CTAGAAAAGCAGAACCAGCAGGG + Intronic
1008151365 6:47956171-47956193 CAGAAGAAACAGAACCAAATTGG - Intronic
1008179340 6:48308925-48308947 CCAGAGAAACAGAACCAATAGGG - Intergenic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1009449440 6:63784290-63784312 CCAGAGAAACAGAACCAATCAGG - Intronic
1009673815 6:66790170-66790192 CTGGAAAAACAAACACAACATGG + Intergenic
1010162419 6:72872363-72872385 CTGTAGAAAATGGACCAACAAGG + Intronic
1010173629 6:73001061-73001083 CTGGAGAAACACATCCTAGAAGG - Intronic
1010406664 6:75513988-75514010 CTAGAGAAACAGAATCGATAAGG + Intergenic
1010582079 6:77612082-77612104 CCAGAGAAACAGACCCAATAGGG + Intergenic
1010595757 6:77761771-77761793 CTGCAGAAAAAGACCCAATAAGG - Intronic
1013023287 6:106241946-106241968 CCAGAGAAACAGAACCATCATGG - Intronic
1013192188 6:107812918-107812940 CCAGAGAAACAGAACCAATAGGG - Intronic
1013259020 6:108419401-108419423 CTGGTGAAAAATAACCAACAAGG + Intronic
1014042969 6:116850861-116850883 CTGCAGAGACAGAACCCTCATGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014720404 6:124911259-124911281 CTGGAGAGACAGGAGCCACAAGG + Intergenic
1015469769 6:133590747-133590769 CCAGGTAAACAGAACCAACAGGG - Intergenic
1016308401 6:142707730-142707752 CCAGAGAAACACAACCAATAGGG - Intergenic
1018117911 6:160606029-160606051 CTTGAGAAACAGGGCTAACAGGG - Intronic
1019133680 6:169895263-169895285 CCAGAAAAACAGAACCAACAGGG + Intergenic
1019572272 7:1718774-1718796 CTGAACAATCTGAACCAACACGG - Intronic
1020822051 7:12982523-12982545 CTAGAGGAACAGAACTAACTAGG - Intergenic
1020988106 7:15161760-15161782 CCAGAGAAACAGAACCAATAGGG - Intergenic
1021351964 7:19604876-19604898 TTAGATAAACAGAAGCAACAGGG - Intergenic
1021468776 7:20977686-20977708 AAAGACAAACAGAACCAACATGG - Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1021814708 7:24435884-24435906 CCAGAGAAACAAAACCAATATGG - Intergenic
1022160576 7:27706551-27706573 CCAGATAAATAGAACCAACAGGG - Intergenic
1022857128 7:34326067-34326089 CCAGAGAAATAGAACCAGCAGGG + Intergenic
1023056922 7:36298253-36298275 CTGGGGAAGCTGAGCCAACAGGG + Intronic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1024259705 7:47564750-47564772 CCAGGGAAGCAGAACCAACAGGG - Intronic
1024263054 7:47586243-47586265 CCAGAGAAACAGATCCAATAGGG - Intergenic
1024507187 7:50171812-50171834 CTAGAGAAGCAGAACCAGTAAGG - Intergenic
1024809722 7:53193766-53193788 CTTGAAAAACAGAACCATTAGGG + Intergenic
1024844157 7:53622195-53622217 CTGAAGAAAAAGAACCTCCAGGG + Intergenic
1025250584 7:57348889-57348911 CTGGAGAAGCAGAACCACCCTGG + Intergenic
1025614521 7:63106506-63106528 CTGGAGCAAGAGCCCCAACAGGG - Intergenic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1028628212 7:92901856-92901878 CCAGAGAAGCAGAACCAGCAGGG + Intergenic
1030192822 7:106826232-106826254 CCAGAGCAACAGAACCAATATGG - Intergenic
1030360165 7:108587335-108587357 CTAGAGCAACAGAACTAATAGGG + Intergenic
1030362965 7:108614657-108614679 CTAGAGAAATAGAATCAATAGGG + Intergenic
1030627369 7:111858860-111858882 CCAGAGAAACAGAACCAATAGGG - Intronic
1030832827 7:114247863-114247885 CCAGAGAAACAGAACCAATAGGG + Intronic
1031466341 7:122116991-122117013 CAATAGAAAAAGAACCAACATGG + Intronic
1031588809 7:123565497-123565519 CCAGAGAAACAGAACAAATATGG - Intergenic
1031834334 7:126664397-126664419 CTAAAGAAACAAAAACAACATGG + Intronic
1032080460 7:128856103-128856125 CTGGAGAAGGTGGACCAACAGGG - Intronic
1032326556 7:130934595-130934617 CCAGAGAAACAGAACCAAGAGGG + Intergenic
1032594099 7:133222276-133222298 CTGGAGAAACTGAACCAGAGAGG - Intergenic
1033073765 7:138229225-138229247 CAAGAGAAACAGAACTAATAAGG - Intergenic
1033315448 7:140293384-140293406 GTGGAGAACAAGAAGCAACAGGG - Intergenic
1034241195 7:149612377-149612399 CAGAAAAAACAGAACCAATAGGG - Intergenic
1036836612 8:12075074-12075096 CTGCAGAAACTAAAACAACATGG - Intergenic
1036858455 8:12321641-12321663 CTGCAGAAACTAAAACAACATGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037708910 8:21339865-21339887 CCAGAGAAACTGAACCAATAGGG - Intergenic
1038093294 8:24278755-24278777 CCAGAGAAACAGAATTAACAGGG + Intergenic
1038315220 8:26478825-26478847 CCAGAGAAACAGAACCAACTGGG - Intronic
1039203647 8:35124706-35124728 CTGGATAACCATAGCCAACATGG + Intergenic
1039292677 8:36113399-36113421 GCAGAGAAACAGAACCAATAGGG + Intergenic
1039384120 8:37116760-37116782 CCAGAGAAACAGAACCAATAGGG - Intergenic
1040091921 8:43407906-43407928 CTGGAAAAACTGAGGCAACAAGG - Intergenic
1040384499 8:46905101-46905123 CTGGAGACAGAGAACCAGCGAGG - Intergenic
1040823066 8:51586253-51586275 CTAGAGAAAGAGAAGCCACATGG + Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1042107533 8:65344723-65344745 CCAGAAAAACAGAACCAATAGGG + Intergenic
1042433286 8:68734229-68734251 CTGGAACAACAGACCCTACATGG - Intronic
1042844531 8:73157081-73157103 CTAGAGAAACAGAACTAATAGGG + Intergenic
1043566067 8:81549267-81549289 CCAGAGAAACAGAACCAACCAGG - Intergenic
1045247631 8:100457558-100457580 TTATAGAAACAGAACAAACATGG - Intergenic
1045360998 8:101433113-101433135 CTGGAAAACCAGGACCAATAAGG - Intergenic
1046235347 8:111417102-111417124 CCAGAGAAACACAACCAATAGGG + Intergenic
1046389026 8:113543376-113543398 CCAGAGAAACAGAAGCAATATGG + Intergenic
1046797149 8:118385605-118385627 CCAGAGAAACAAAACCAAGAGGG - Intronic
1047262613 8:123275302-123275324 GTGGAGGAACAGAACCAAAGCGG + Intronic
1047503425 8:125460061-125460083 CTGGAGAAATAGCAACAGCAGGG - Intergenic
1047535742 8:125718160-125718182 CTAGAGAAACAGAACCATTAGGG + Intergenic
1047722963 8:127659214-127659236 CTGGAGAAATAGAACCCATAGGG + Intergenic
1047743071 8:127822743-127822765 CGGGAGAAACAGCACCTACAGGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048426378 8:134327791-134327813 AGGGAAAAACAGAAGCAACAAGG - Intergenic
1048503806 8:135002691-135002713 CTGGAGAATGAGAGCCCACATGG + Intergenic
1048544173 8:135370703-135370725 ATGGAGTAAGTGAACCAACATGG + Intergenic
1049089338 8:140502609-140502631 CCAGAGAGACAGAATCAACAGGG + Intergenic
1049156840 8:141072592-141072614 CTGGGTTAAGAGAACCAACAAGG - Intergenic
1049913809 9:296927-296949 ATGGAAAATCAGAACCCACATGG - Intronic
1050162730 9:2734807-2734829 CTGGATGAAGAGAACCAACAAGG - Intronic
1051027558 9:12631130-12631152 CTGGAAAAAAAGAATCAACAAGG + Intergenic
1051345049 9:16143882-16143904 CCAGAGAAACAGAAGCAATAGGG + Intergenic
1051476116 9:17510761-17510783 CTAGGAAAACAGAACCAACATGG - Intergenic
1052029494 9:23611912-23611934 CCAGAGAAACAGAACCAATAGGG + Intergenic
1052032627 9:23645662-23645684 CCAGAGAAAGAGAACCAACTGGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1055090082 9:72354978-72355000 ATGGAAAATCATAACCAACATGG - Exonic
1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG + Exonic
1056103409 9:83322600-83322622 CTCTAGAAAGAGAACCCACATGG - Intronic
1056740074 9:89246785-89246807 CCAGAGAAACAGATCCAATAGGG + Intergenic
1056964169 9:91152238-91152260 CTCCAGAGACAGAGCCAACAGGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1058900506 9:109438578-109438600 CTGGATAAAGAGAACCCACTGGG + Intronic
1058901879 9:109449193-109449215 CTTGAGGACCAGAACCCACAGGG + Intronic
1059453644 9:114386600-114386622 CTGGAGAAACTGGCCCCACAAGG + Intronic
1060520909 9:124293593-124293615 CTGGAGATTCAAAACCAACTGGG - Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1061661775 9:132135089-132135111 CCAGAGAGACAGAACCAATAGGG - Intergenic
1062077146 9:134595572-134595594 CTGGAGAACCAGGAGCACCAAGG - Intergenic
1062097648 9:134711204-134711226 GGGGAGAAACAGAGCCAACCTGG - Intronic
1203394802 Un_KI270512v1:15440-15462 CAGGAGAACCAGAGCCAAGATGG - Intergenic
1185521655 X:744707-744729 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185522645 X:752997-753019 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185749706 X:2600959-2600981 CGGGAAAAACAGGAGCAACACGG - Intergenic
1186255266 X:7711362-7711384 CTGGAGAAAGTGAAACCACATGG + Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186876940 X:13826349-13826371 CTGAAGAAACAAAGCCAAAATGG + Intronic
1187058515 X:15763627-15763649 CTCCAGAAGCAGAACCAATAAGG + Intronic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188278257 X:28228789-28228811 CCAGAGAAACAGAACCAATAGGG - Intergenic
1188820691 X:34771090-34771112 CTGGAGAAACAACACCAAGCTGG + Intergenic
1191041445 X:56085227-56085249 CCAGAGAAACAAAACCAAGAGGG + Intergenic
1193160498 X:78223386-78223408 CTAGAGAAACTGAAACAACAAGG + Intergenic
1193257959 X:79371842-79371864 ATGGAGCAACTGAACCAACTGGG - Intergenic
1193902710 X:87202611-87202633 CTGGAGAAAGAGAAGCCATAGGG - Intergenic
1194804240 X:98307504-98307526 CTGGAGAACCTGACCCAAGATGG + Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1195097044 X:101512715-101512737 CTAGAGAAATAGAACCAATAGGG + Intronic
1195287788 X:103402174-103402196 CCAGAGAAACAGAACCAGTAGGG + Intergenic
1195919471 X:109968284-109968306 CTAAAGAAACAGAACCAGTAGGG - Intergenic
1196057234 X:111368862-111368884 CTAGAGAGACAGAACTAATACGG + Intronic
1196282306 X:113836235-113836257 CCAGAGAAACAGAACCAATAGGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196409847 X:115406785-115406807 CTGCAGAAACAGAGCCACAAAGG - Intergenic
1196600300 X:117594047-117594069 CTAGAGAAAAAGAACAAAGAGGG + Intergenic
1196984842 X:121257064-121257086 CTGATGAAGCAGAACCAATAGGG + Intergenic
1198066831 X:133106542-133106564 CTGGAGAAATAGAAACAATAGGG - Intergenic
1198447213 X:136729077-136729099 CCAGAGAAACAGAACCAATGTGG - Intronic
1198845288 X:140903831-140903853 CTGGAGAGACAGCAACAACAAGG - Intergenic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic
1199223825 X:145348605-145348627 TGGGAGACACAGAACCAAGAGGG + Intergenic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1200204758 X:154307883-154307905 CTGGAAATGCAGAACCAAAAGGG + Intronic
1201442290 Y:14021305-14021327 TTTGAGAAGCAGAACAAACATGG - Intergenic
1201890519 Y:18938826-18938848 CCAGAGAAACAGAACCAGTAGGG + Intergenic
1201945982 Y:19510491-19510513 CTGAACAAACAGAACAAAAAAGG + Intergenic