ID: 1048062787

View in Genome Browser
Species Human (GRCh38)
Location 8:130937672-130937694
Sequence TGCAAATGTCCTTGCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048062787_1048062790 -10 Left 1048062787 8:130937672-130937694 CCTTTCCAGCAAGGACATTTGCA 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1048062790 8:130937685-130937707 GACATTTGCACTTTATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048062787 Original CRISPR TGCAAATGTCCTTGCTGGAA AGG (reversed) Intronic
902197677 1:14809856-14809878 TGGAAATGCCCCTGGTGGAAGGG - Intronic
905303205 1:36999456-36999478 TGAAAAGGTCCTTTCTGGAAAGG + Intronic
906167481 1:43697653-43697675 TTCCAATGTCCTGGCTGGGATGG + Intronic
907184704 1:52601008-52601030 TGCAAAGGTCCTGGGGGGAAAGG - Intergenic
908958037 1:69659534-69659556 TTCAACTGTCCTTCCTTGAAAGG - Intronic
910287746 1:85574364-85574386 TGCGAATGGCCTTGCTGTCATGG - Intronic
911311064 1:96292398-96292420 TGTAAATGTTGTTGCTGTAATGG - Intergenic
911650961 1:100387932-100387954 TACAAATCTACTTGCTGAAAGGG - Intronic
912529880 1:110312605-110312627 TGGAGAGGTCCTTGCTGGAGAGG + Intergenic
912810827 1:112793172-112793194 TTGAAATGTCCTTGGTGGAGAGG + Intergenic
919775294 1:201190532-201190554 TGAAAATGTCCTTGCTAAAAAGG + Intergenic
920024869 1:202986934-202986956 TGCAACTGTCCTTACTGACATGG - Intergenic
921371911 1:214432560-214432582 TTCAAATGTCCTTTGTAGAATGG + Intronic
923341732 1:233013445-233013467 TCCAAATGTCCTTCTTGAAAGGG - Intronic
1063492367 10:6476498-6476520 TGCAAATGTTCTTGCTTAAAAGG + Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065967613 10:30782308-30782330 AGCAAAAGCCTTTGCTGGAAGGG - Intergenic
1067200786 10:44170221-44170243 ACCAAATGCCCTTGCTGGGACGG + Intergenic
1068132309 10:52910015-52910037 TGATAATGTCATTGTTGGAAAGG + Intergenic
1068634760 10:59336570-59336592 TGCCCATGTCCTAGCTGAAAGGG + Intronic
1068840650 10:61610189-61610211 TACAAATGTTTTTACTGGAAAGG - Intergenic
1068941924 10:62689031-62689053 AGCAAATATCCATGCTGGACTGG + Intergenic
1069790348 10:71015599-71015621 TGCAAATGTCCTTTCCAGAGAGG - Intergenic
1072502512 10:96032218-96032240 TCCAAAGGTCCTTCCTGGAGAGG - Exonic
1074154290 10:110784825-110784847 AGTGAATGACCTTGCTGGAATGG - Exonic
1076139219 10:128066215-128066237 TGAAAATGATCTTTCTGGAAGGG - Intronic
1076179284 10:128393763-128393785 GTCTAACGTCCTTGCTGGAATGG + Intergenic
1077374994 11:2201570-2201592 GGCAAATGTCCAAGCTGGCAGGG - Intergenic
1077755241 11:5021707-5021729 TGCACATGGCTTGGCTGGAATGG + Intergenic
1081021083 11:37948257-37948279 TGTAAAAGTCCATGATGGAAGGG + Intergenic
1081404275 11:42678343-42678365 TGGAAATGTTCTTGCTGGGCTGG + Intergenic
1081836959 11:46163854-46163876 TAAAAATCTGCTTGCTGGAATGG - Intergenic
1085036073 11:73300843-73300865 TCAAAGTGTCCTTGCTGGAGAGG + Intergenic
1085902389 11:80716838-80716860 TGCAAATGGCTCTGCTGGGATGG + Intergenic
1086102941 11:83120272-83120294 TGAAAGTTTCCTTGCTGGACGGG - Intergenic
1086432680 11:86750479-86750501 CGCAGATGTCCTTAATGGAATGG + Intergenic
1087102670 11:94380457-94380479 TGCGGATGACCTTGCTGGACAGG + Exonic
1088664766 11:112083573-112083595 TGCAAATTTCCCTGCTGGATGGG + Exonic
1089073551 11:115718994-115719016 TGCAAAAGTCCTTCAAGGAATGG - Intergenic
1089247854 11:117135716-117135738 TGGAAAGGCCCTTGCTGAAAAGG - Intergenic
1089258859 11:117208845-117208867 TGGAAAGGCCCTTGCTGAAAAGG + Intronic
1092099169 12:5869151-5869173 TGCGAATGGCCCTGCTGGATGGG - Intronic
1094361253 12:29633811-29633833 TGCAGGTGTCCTTGCTGACAAGG + Intronic
1098088272 12:66872124-66872146 TGCATGTATCCTAGCTGGAAGGG - Intergenic
1098326964 12:69312906-69312928 TGTTAATGTCCTTGCTGTCAAGG - Intergenic
1098560257 12:71864967-71864989 TGGTAATGTCCTTGCTGTCAAGG + Intronic
1100146256 12:91681503-91681525 TGCAAATGCAGTTGCTGGATAGG - Intergenic
1101972066 12:109321860-109321882 TGCAAAACTCTTTTCTGGAATGG - Intergenic
1103175086 12:118855875-118855897 TGCAAATGTCTTTGCTAAGAAGG + Intergenic
1103308613 12:119987603-119987625 AGAACATTTCCTTGCTGGAATGG + Intergenic
1108697802 13:52918088-52918110 TGCAAATTTCTTTGGTGGGAAGG + Intergenic
1110557565 13:76877634-76877656 TGCAGATCTCCTGGCTGCAATGG - Intergenic
1111204883 13:84994000-84994022 TGCAAATATACTTGTTGGACTGG + Intergenic
1112691170 13:101896273-101896295 TGAAACTGTCCTTGGTGGTATGG - Intronic
1116713072 14:48394122-48394144 TGCAGATGGGCCTGCTGGAATGG + Intergenic
1117058085 14:51933313-51933335 GACAAATGTCGTTGCAGGAAAGG + Intronic
1117573622 14:57074710-57074732 TGCAAATGTCCTTCCTTAAAGGG + Intergenic
1118118036 14:62803489-62803511 TGGAAATGTCAGTGCTGGCAGGG + Intronic
1120005416 14:79351204-79351226 TGCAAATATCCTCTCTGGAAGGG - Intronic
1120845298 14:89119863-89119885 TGCCCATGTCCTAGCTGCAAGGG - Intergenic
1126645409 15:50870395-50870417 TGCAAAGGTCCTTTCTGGAGGGG + Intergenic
1132089072 15:98933130-98933152 TGCTAATGTCCTTGCCTGACGGG - Intronic
1135929409 16:26724128-26724150 TGCTATTGTCCGTGCTGGAGAGG - Intergenic
1140882669 16:79213121-79213143 TTCTCATGTGCTTGCTGGAACGG - Intergenic
1144663980 17:17089815-17089837 AGGGAATGTCATTGCTGGAAAGG + Intronic
1146672932 17:34754352-34754374 TGCAAATGTGCTTGCTGAGTGGG + Intergenic
1147912461 17:43864231-43864253 TGCACCTGTCCCTGCTGGAAAGG + Intergenic
1151352156 17:73538109-73538131 TGCACTTGGCCTGGCTGGAAAGG + Intronic
1153740717 18:8124527-8124549 TGCAAATGTACTTGATGCCAAGG - Intronic
1155226874 18:23736985-23737007 TGGGATTGTCCTTGCTGGCATGG + Intronic
1155425459 18:25702047-25702069 TTAGAATGTCCTTCCTGGAATGG - Intergenic
1156112745 18:33747003-33747025 TGTAAAATTCCTTGCTGTAATGG - Exonic
1158093297 18:53740834-53740856 TATATCTGTCCTTGCTGGAAAGG + Intergenic
1158284143 18:55860429-55860451 TGAAGATGTATTTGCTGGAATGG + Intergenic
1165854553 19:38871588-38871610 TGCCAATTTCCTTGCTCCAAGGG - Intronic
1167060655 19:47143646-47143668 TGCAGATCTTCATGCTGGAAAGG - Intronic
1167637152 19:50661787-50661809 TGCAAATGTCCGGCCTGGATTGG + Intronic
1167949000 19:53011580-53011602 TGCCAATGTTCTTGGAGGAAGGG - Intergenic
925224874 2:2175116-2175138 TGCAAATGTCCTCTCTGAGAAGG + Intronic
926053809 2:9761944-9761966 TGCAAATGGCCTTGCTGAGCTGG - Intergenic
926150785 2:10424644-10424666 TGCTAATGTGCCTGCTGGGATGG + Intronic
926635183 2:15170787-15170809 TTAAAATGTACTTGTTGGAATGG - Intronic
928202758 2:29261008-29261030 AGCAAACGTCATTGCAGGAAAGG - Intronic
930332983 2:50009429-50009451 TTGAAATTTACTTGCTGGAAAGG + Intronic
931923715 2:67048122-67048144 AGCAAAGGTCCTTGGTGGGAAGG + Intergenic
933199251 2:79430234-79430256 TCCAAATGTTCTTGCTTCAAAGG + Intronic
934527476 2:95060473-95060495 TGGCACTGTCCCTGCTGGAATGG + Intergenic
934928091 2:98396211-98396233 TGTAAATGTACTTCCTGGAGAGG - Exonic
935837170 2:107067591-107067613 TGCAATAGTCCTTTTTGGAAAGG - Intergenic
940955631 2:159724139-159724161 TTCAAATGTACTTGCTAGATTGG + Intronic
941343734 2:164340433-164340455 TGCAACCATCCTTGCTGGGAAGG + Intergenic
941380203 2:164783533-164783555 AGCACATGTCCTTGCTGGGCTGG + Intronic
941832516 2:169978136-169978158 TGTTAATGTCCTTGGTGGCAAGG + Intronic
942101522 2:172588921-172588943 TGCCACTGCCCATGCTGGAAGGG + Intronic
943337918 2:186641677-186641699 AGCAAATCTCCTTCCTGGAAAGG + Intronic
943347258 2:186754085-186754107 TTCAAATAGTCTTGCTGGAACGG + Intronic
946483897 2:220082292-220082314 GGCAAATGTCATTGATAGAAAGG - Intergenic
946916556 2:224528841-224528863 TGCAAATACCTTTGCTGCAAAGG + Intronic
947253173 2:228132208-228132230 TGCAAATCCCCCTGCTGAAATGG + Intronic
1169759671 20:9077692-9077714 TGGACATGTCCCTGCTGGGAAGG - Intronic
1173359693 20:42331358-42331380 AGCAAATGTCTTTGTTGCAAGGG - Intronic
1174278844 20:49423621-49423643 TGGATATGTACTGGCTGGAAAGG + Intronic
1176728323 21:10463422-10463444 AGAAAGTGTCCTTCCTGGAATGG - Intergenic
1178304122 21:31476405-31476427 TGCAGATGTTCTTCCTGAAATGG - Intronic
1179142627 21:38740010-38740032 TCAAAATGTCATTGCTTGAATGG - Intergenic
1179582669 21:42353305-42353327 TGCAAATGTCCTTTCTGCCCAGG + Intergenic
1182584009 22:31332775-31332797 TGCAAACATCATTGCTTGAAAGG - Intronic
1182653930 22:31874482-31874504 TGCAGATCTCATTACTGGAAAGG - Intronic
1183157270 22:36085121-36085143 GGCAGGTGTCCCTGCTGGAAGGG - Intergenic
949908117 3:8875938-8875960 TGTAAATGTCTTTTCTTGAATGG - Intronic
951772922 3:26278789-26278811 TGTAAATTTCCTTACTGGAAAGG + Intergenic
951802748 3:26614634-26614656 AGGAAATGCCCTTGCTGGAGTGG - Intergenic
953410702 3:42689069-42689091 TGCAGTTGTCCTTGGCGGAAGGG - Intronic
955966080 3:64390573-64390595 TCCAGATGTTCTTGGTGGAAGGG - Intronic
957334411 3:78808619-78808641 TGCAAATGTCATAGCTTCAATGG + Intronic
958268342 3:91466708-91466730 AGCAAATGATCTGGCTGGAAGGG + Intergenic
959672277 3:108992274-108992296 TGTAAATGTTCTACCTGGAATGG + Intronic
960990297 3:123305803-123305825 AGGAAATGGCTTTGCTGGAAGGG - Intronic
961112139 3:124293844-124293866 TTAAAATGTCCTAGCTGGAAGGG + Intronic
962458983 3:135591506-135591528 TCCAAATGTCCTTGATTGGAGGG - Intergenic
964142509 3:153419924-153419946 TGCACATGTACATGCTGGCAGGG + Intergenic
969426583 4:7128001-7128023 TGCAAAAGTCCCTGCAGGGATGG - Intergenic
973084928 4:46046624-46046646 TGAAAATCTCTTTGCTGAAAAGG + Intronic
975739386 4:77414473-77414495 ATAAAATGTCCTTGCTGAAATGG + Intronic
977402267 4:96547509-96547531 TGCAAAAGTGCTTGCTGAAAGGG - Intergenic
982864931 4:160499026-160499048 TGCAAATCTCCTTGCTGTTTTGG + Intergenic
984916056 4:184725822-184725844 AGCAAATGAACTTGGTGGAAAGG + Intronic
985959097 5:3286360-3286382 TGCAAATGTGAGGGCTGGAAAGG - Intergenic
986093784 5:4536471-4536493 AGAAAGTGTGCTTGCTGGAATGG + Intergenic
987165309 5:15192270-15192292 TGCAAATGTACCTGCTGGGGCGG + Intergenic
987550561 5:19375031-19375053 TGCAAATGTCTGTCCTGAAAAGG + Intergenic
987758257 5:22125017-22125039 TGCACCTGTCCTTGCTTCAAGGG + Intronic
988826939 5:34946390-34946412 TCCAAATGTCCTTGGTAAAATGG - Intronic
989184171 5:38606771-38606793 AGAAAGTGTCCTTGATGGAAAGG - Intronic
989493674 5:42086615-42086637 TGGTAATGACCTTGCTAGAATGG + Intergenic
989563262 5:42875163-42875185 TATAAATGTCCTTGATGGCAGGG + Intronic
990190886 5:53259338-53259360 TGCAAAAGTCCAGGTTGGAAGGG + Intergenic
990788204 5:59447308-59447330 TGCAAGATTGCTTGCTGGAATGG + Intronic
990861309 5:60330793-60330815 TGCAAATGTTCTGGCTAGCAAGG - Intronic
990875709 5:60482763-60482785 TGGAAATGTATTTCCTGGAATGG + Intronic
996289649 5:121836901-121836923 AACAAGTGTGCTTGCTGGAAGGG - Intergenic
997745842 5:136299537-136299559 TGCAAATTTTCTTGATGGAAGGG - Intronic
1003601307 6:7519960-7519982 TGTAATTGTCCTTGCTGAAGTGG + Intergenic
1006890916 6:37427396-37427418 TGGAATTGTCCTTTTTGGAAAGG - Intergenic
1006996594 6:38266978-38267000 GGCAGATGGCCTTGCTGGAGAGG - Intronic
1007263502 6:40580343-40580365 TGCACATGTCCTGGCTGAGAAGG + Intronic
1008076155 6:47148330-47148352 TGCTAACATCCTTGCTGAAATGG - Intergenic
1008681876 6:53880809-53880831 TGCAACTGTCATTCCTGGAATGG + Intronic
1008986860 6:57554879-57554901 AGCAAATGATCTGGCTGGAAGGG - Intronic
1009174819 6:60447440-60447462 AGCAAATGATCTGGCTGGAAGGG - Intergenic
1012771532 6:103441515-103441537 TGCAAATGTCCTCTCTGCAAAGG - Intergenic
1012799672 6:103809145-103809167 TGCAAATATTCTTGCTATAATGG - Intergenic
1013134901 6:107272653-107272675 TGCCAATCTGCTTTCTGGAAAGG - Intronic
1013192167 6:107812672-107812694 AGAAAATGTCCCTGCTGGAAGGG - Intronic
1017345802 6:153379483-153379505 GGGAAATGTGCATGCTGGAATGG + Intergenic
1018260360 6:161964358-161964380 TGCAAAGATTCTTTCTGGAAGGG + Intronic
1020395136 7:7706878-7706900 TGCAAATGTTTGTGCTGCAATGG - Intronic
1021804712 7:24343501-24343523 TGCAAATGCCCTGGGTGGGAGGG - Intergenic
1021805355 7:24349485-24349507 TGCAAATGCCCTGGGTGGGAGGG + Intergenic
1024460716 7:49656773-49656795 TGCAAATGTCAATTCTGGAAGGG - Intergenic
1025020210 7:55474684-55474706 TGAAAAAGTCCCTGCTGGACTGG + Intronic
1029243067 7:99178176-99178198 TGCAACTATCCATTCTGGAATGG - Intronic
1030795743 7:113785004-113785026 GCCACATGTCCTTGCTGCAAGGG - Intergenic
1032995680 7:137443673-137443695 TCCCAATGTCCATTCTGGAAGGG + Intronic
1034460088 7:151193322-151193344 GGCAAATATCCTGGCAGGAATGG - Exonic
1034601774 7:152264548-152264570 AGAAATTGTCCTTCCTGGAATGG + Intronic
1034893325 7:154859197-154859219 TGCAAATGCCTGTGCTGGCATGG - Intronic
1039811644 8:41054359-41054381 CCCAATTGTCCTTGTTGGAATGG + Intergenic
1045277151 8:100718278-100718300 TGAAAATGTCCTTCCTGCAGCGG - Exonic
1046721136 8:117620328-117620350 AGAAAATGTTTTTGCTGGAATGG - Intergenic
1046772505 8:118130068-118130090 ATAAAACGTCCTTGCTGGAAGGG + Intergenic
1048062787 8:130937672-130937694 TGCAAATGTCCTTGCTGGAAAGG - Intronic
1048338652 8:133522297-133522319 TGCAAATGGCTTCCCTGGAATGG + Intronic
1048598820 8:135896682-135896704 GCCAAATGTCACTGCTGGAATGG + Intergenic
1051709138 9:19912200-19912222 TACAAATGTCAGAGCTGGAAAGG + Intergenic
1052420372 9:28235354-28235376 TGCATATGTCCTTCCTGGGGAGG - Intronic
1053258972 9:36644871-36644893 TGGAAATATCCCAGCTGGAAAGG - Intronic
1053473450 9:38363817-38363839 TGCAGATCACCTTGCTGGAGAGG - Intergenic
1055140515 9:72871891-72871913 TTCAGATGTTCTTGCTGGAATGG + Intergenic
1056596437 9:88011639-88011661 TGCCAATGTGCTGGCAGGAAAGG + Intergenic
1057600366 9:96451291-96451313 TCCGAATATTCTTGCTGGAAAGG - Intronic
1057931590 9:99198160-99198182 TGCCAACGCCCTTGCTAGAATGG - Intergenic
1058313398 9:103533962-103533984 TGCACATGTCTTGGCTGGGATGG - Intergenic
1058900750 9:109440161-109440183 TGCAAATTTCAGTTCTGGAAGGG + Intronic
1058938418 9:109790786-109790808 TGAAAATGTCCTTGCTCCAGTGG + Intronic
1058955110 9:109939251-109939273 TGAAAAGTTCTTTGCTGGAAAGG - Intronic
1059350713 9:113662908-113662930 TGCCAGTGTCCTGGCTGGCATGG + Intergenic
1185790004 X:2922037-2922059 CACAAATGTCATTGTTGGAAGGG + Intronic
1188703032 X:33288791-33288813 TTCTAATGACCTTTCTGGAAAGG - Intronic
1188942513 X:36257716-36257738 TGCAAATATTCTTGCTGGCCAGG - Intronic
1190932478 X:54960967-54960989 AAAAAATGTCCTTGCTGGGAGGG + Intronic
1193390281 X:80918644-80918666 TGGAAAAGTCCTTACTGGAGTGG - Intergenic
1194934356 X:99929890-99929912 TGCAAATCTCTTTGCTTGCATGG + Intergenic
1195759782 X:108233943-108233965 TCCAACTGTCCATGATGGAAAGG - Intronic
1200076454 X:153553686-153553708 AGCAAAGGTCCTGGCGGGAAAGG + Intronic
1200522317 Y:4225726-4225748 TGCTAATGTAATTTCTGGAAGGG - Intergenic
1200945883 Y:8836720-8836742 TGCTAATTTCCCTTCTGGAAAGG + Intergenic
1201213617 Y:11702904-11702926 TGGAAAGGACCTTGATGGAATGG + Intergenic
1201284308 Y:12365905-12365927 CACAAATGTCATTGCTGGAAGGG - Intergenic