ID: 1048073174

View in Genome Browser
Species Human (GRCh38)
Location 8:131041620-131041642
Sequence AACCGGGCCGGGGGTGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 616}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048073153_1048073174 6 Left 1048073153 8:131041591-131041613 CCCGCCCCCGCGCCAAGCCACGC 0: 1
1: 0
2: 3
3: 36
4: 365
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073154_1048073174 5 Left 1048073154 8:131041592-131041614 CCGCCCCCGCGCCAAGCCACGCC 0: 1
1: 0
2: 2
3: 50
4: 431
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073160_1048073174 -6 Left 1048073160 8:131041603-131041625 CCAAGCCACGCCCCCGGAACCGG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073159_1048073174 -1 Left 1048073159 8:131041598-131041620 CCGCGCCAAGCCACGCCCCCGGA 0: 1
1: 0
2: 3
3: 12
4: 220
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073157_1048073174 0 Left 1048073157 8:131041597-131041619 CCCGCGCCAAGCCACGCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073156_1048073174 1 Left 1048073156 8:131041596-131041618 CCCCGCGCCAAGCCACGCCCCCG 0: 1
1: 1
2: 3
3: 33
4: 257
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073152_1048073174 21 Left 1048073152 8:131041576-131041598 CCGCGGTGACTTAAACCCGCCCC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073155_1048073174 2 Left 1048073155 8:131041595-131041617 CCCCCGCGCCAAGCCACGCCCCC 0: 1
1: 0
2: 1
3: 74
4: 778
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616
1048073151_1048073174 22 Left 1048073151 8:131041575-131041597 CCCGCGGTGACTTAAACCCGCCC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG 0: 1
1: 0
2: 4
3: 64
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048073174 Original CRISPR AACCGGGCCGGGGGTGGCGG AGG Exonic