ID: 1048073795

View in Genome Browser
Species Human (GRCh38)
Location 8:131046775-131046797
Sequence GTCACCACTTAGGCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048073790_1048073795 26 Left 1048073790 8:131046726-131046748 CCCTCATGCATGTGCTTGTCTTC No data
Right 1048073795 8:131046775-131046797 GTCACCACTTAGGCTTTTGTTGG No data
1048073791_1048073795 25 Left 1048073791 8:131046727-131046749 CCTCATGCATGTGCTTGTCTTCT No data
Right 1048073795 8:131046775-131046797 GTCACCACTTAGGCTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048073795 Original CRISPR GTCACCACTTAGGCTTTTGT TGG Intergenic
No off target data available for this crispr