ID: 1048075650

View in Genome Browser
Species Human (GRCh38)
Location 8:131067422-131067444
Sequence TGTTTATTGTCACCAAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048075650_1048075651 -5 Left 1048075650 8:131067422-131067444 CCAGTGCTTGGTGACAATAAACA No data
Right 1048075651 8:131067440-131067462 AAACAGACTGATGTTTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048075650 Original CRISPR TGTTTATTGTCACCAAGCAC TGG (reversed) Intergenic
No off target data available for this crispr