ID: 1048075854

View in Genome Browser
Species Human (GRCh38)
Location 8:131070333-131070355
Sequence GTCCTTGATACCCACAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048075854_1048075860 10 Left 1048075854 8:131070333-131070355 CCCATTCTGTGGGTATCAAGGAC No data
Right 1048075860 8:131070366-131070388 AGATAATCAGAATAATGACAAGG No data
1048075854_1048075861 17 Left 1048075854 8:131070333-131070355 CCCATTCTGTGGGTATCAAGGAC No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048075854 Original CRISPR GTCCTTGATACCCACAGAAT GGG (reversed) Intergenic
No off target data available for this crispr