ID: 1048075857

View in Genome Browser
Species Human (GRCh38)
Location 8:131070355-131070377
Sequence TTCTGATTATCTTCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048075857_1048075861 -5 Left 1048075857 8:131070355-131070377 CCCAGGCCTGAAGATAATCAGAA No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048075857 Original CRISPR TTCTGATTATCTTCAGGCCT GGG (reversed) Intergenic
No off target data available for this crispr