ID: 1048075858

View in Genome Browser
Species Human (GRCh38)
Location 8:131070356-131070378
Sequence ATTCTGATTATCTTCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048075858_1048075861 -6 Left 1048075858 8:131070356-131070378 CCAGGCCTGAAGATAATCAGAAT No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048075858 Original CRISPR ATTCTGATTATCTTCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr