ID: 1048075861

View in Genome Browser
Species Human (GRCh38)
Location 8:131070373-131070395
Sequence CAGAATAATGACAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048075855_1048075861 16 Left 1048075855 8:131070334-131070356 CCATTCTGTGGGTATCAAGGACC No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data
1048075857_1048075861 -5 Left 1048075857 8:131070355-131070377 CCCAGGCCTGAAGATAATCAGAA No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data
1048075854_1048075861 17 Left 1048075854 8:131070333-131070355 CCCATTCTGTGGGTATCAAGGAC No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data
1048075853_1048075861 18 Left 1048075853 8:131070332-131070354 CCCCATTCTGTGGGTATCAAGGA No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data
1048075858_1048075861 -6 Left 1048075858 8:131070356-131070378 CCAGGCCTGAAGATAATCAGAAT No data
Right 1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048075861 Original CRISPR CAGAATAATGACAAGGAGAA TGG Intergenic
No off target data available for this crispr