ID: 1048077337

View in Genome Browser
Species Human (GRCh38)
Location 8:131086000-131086022
Sequence TATAAAGCAGCAGGAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048077330_1048077337 9 Left 1048077330 8:131085968-131085990 CCTCTCTGGCCATGTGATATCTC No data
Right 1048077337 8:131086000-131086022 TATAAAGCAGCAGGAGGCCCTGG No data
1048077331_1048077337 0 Left 1048077331 8:131085977-131085999 CCATGTGATATCTCCCACCATGT No data
Right 1048077337 8:131086000-131086022 TATAAAGCAGCAGGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048077337 Original CRISPR TATAAAGCAGCAGGAGGCCC TGG Intergenic
No off target data available for this crispr