ID: 1048079187

View in Genome Browser
Species Human (GRCh38)
Location 8:131106447-131106469
Sequence ATGGAGAAGCAATAAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048079187_1048079190 -1 Left 1048079187 8:131106447-131106469 CCCTTCTCTTATTGCTTCTCCAT No data
Right 1048079190 8:131106469-131106491 TCTTTTCTAAGTCCTCATTTTGG No data
1048079187_1048079191 0 Left 1048079187 8:131106447-131106469 CCCTTCTCTTATTGCTTCTCCAT No data
Right 1048079191 8:131106470-131106492 CTTTTCTAAGTCCTCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048079187 Original CRISPR ATGGAGAAGCAATAAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr