ID: 1048080537

View in Genome Browser
Species Human (GRCh38)
Location 8:131121837-131121859
Sequence AAGTTTCCCCAGAGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048080537_1048080544 14 Left 1048080537 8:131121837-131121859 CCCACTTTCCTCTGGGGAAACTT No data
Right 1048080544 8:131121874-131121896 CCTCTCTCAGCAGAGGCAGAAGG No data
1048080537_1048080546 24 Left 1048080537 8:131121837-131121859 CCCACTTTCCTCTGGGGAAACTT No data
Right 1048080546 8:131121884-131121906 CAGAGGCAGAAGGGAGATGAAGG No data
1048080537_1048080545 15 Left 1048080537 8:131121837-131121859 CCCACTTTCCTCTGGGGAAACTT No data
Right 1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG No data
1048080537_1048080541 7 Left 1048080537 8:131121837-131121859 CCCACTTTCCTCTGGGGAAACTT No data
Right 1048080541 8:131121867-131121889 TTTCCAGCCTCTCTCAGCAGAGG No data
1048080537_1048080547 25 Left 1048080537 8:131121837-131121859 CCCACTTTCCTCTGGGGAAACTT No data
Right 1048080547 8:131121885-131121907 AGAGGCAGAAGGGAGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048080537 Original CRISPR AAGTTTCCCCAGAGGAAAGT GGG (reversed) Intergenic
No off target data available for this crispr