ID: 1048080545

View in Genome Browser
Species Human (GRCh38)
Location 8:131121875-131121897
Sequence CTCTCTCAGCAGAGGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048080536_1048080545 18 Left 1048080536 8:131121834-131121856 CCTCCCACTTTCCTCTGGGGAAA No data
Right 1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG No data
1048080538_1048080545 14 Left 1048080538 8:131121838-131121860 CCACTTTCCTCTGGGGAAACTTA No data
Right 1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG No data
1048080537_1048080545 15 Left 1048080537 8:131121837-131121859 CCCACTTTCCTCTGGGGAAACTT No data
Right 1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG No data
1048080540_1048080545 7 Left 1048080540 8:131121845-131121867 CCTCTGGGGAAACTTAGGAGTTT No data
Right 1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG No data
1048080532_1048080545 25 Left 1048080532 8:131121827-131121849 CCACTTTCCTCCCACTTTCCTCT No data
Right 1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048080545 Original CRISPR CTCTCTCAGCAGAGGCAGAA GGG Intergenic
No off target data available for this crispr