ID: 1048084617

View in Genome Browser
Species Human (GRCh38)
Location 8:131163150-131163172
Sequence ACTTTGGTTTAGAACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048084612_1048084617 8 Left 1048084612 8:131163119-131163141 CCCTGAGTCTCATTTCTTAGGCT No data
Right 1048084617 8:131163150-131163172 ACTTTGGTTTAGAACTTGGGTGG No data
1048084613_1048084617 7 Left 1048084613 8:131163120-131163142 CCTGAGTCTCATTTCTTAGGCTT No data
Right 1048084617 8:131163150-131163172 ACTTTGGTTTAGAACTTGGGTGG No data
1048084610_1048084617 11 Left 1048084610 8:131163116-131163138 CCTCCCTGAGTCTCATTTCTTAG No data
Right 1048084617 8:131163150-131163172 ACTTTGGTTTAGAACTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048084617 Original CRISPR ACTTTGGTTTAGAACTTGGG TGG Intergenic
No off target data available for this crispr