ID: 1048085580

View in Genome Browser
Species Human (GRCh38)
Location 8:131174820-131174842
Sequence CTGTTTACACATATTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048085574_1048085580 29 Left 1048085574 8:131174768-131174790 CCAACCTTTGATTGGCCAAACCT No data
Right 1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG No data
1048085577_1048085580 14 Left 1048085577 8:131174783-131174805 CCAAACCTCAGTGATTGGCACAA No data
Right 1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG No data
1048085575_1048085580 25 Left 1048085575 8:131174772-131174794 CCTTTGATTGGCCAAACCTCAGT No data
Right 1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG No data
1048085578_1048085580 9 Left 1048085578 8:131174788-131174810 CCTCAGTGATTGGCACAAGAGTA No data
Right 1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048085580 Original CRISPR CTGTTTACACATATTCAGTA AGG Intergenic
No off target data available for this crispr