ID: 1048085819

View in Genome Browser
Species Human (GRCh38)
Location 8:131178332-131178354
Sequence TAAAAAAAGTAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048085815_1048085819 18 Left 1048085815 8:131178291-131178313 CCTGAAGGACTTGCCTGAGCTTG No data
Right 1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG No data
1048085816_1048085819 5 Left 1048085816 8:131178304-131178326 CCTGAGCTTGACTTACAGTTCAC No data
Right 1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048085819 Original CRISPR TAAAAAAAGTAGAAGGAGGC TGG Intergenic
No off target data available for this crispr