ID: 1048096461

View in Genome Browser
Species Human (GRCh38)
Location 8:131300595-131300617
Sequence CTTCCATGTGGTATTAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048096461_1048096466 22 Left 1048096461 8:131300595-131300617 CCAGGCTTAATACCACATGGAAG No data
Right 1048096466 8:131300640-131300662 TTTTCCAAAGTGACAGCTCTTGG No data
1048096461_1048096464 -7 Left 1048096461 8:131300595-131300617 CCAGGCTTAATACCACATGGAAG No data
Right 1048096464 8:131300611-131300633 ATGGAAGCTGCCAAGGCTTATGG 0: 67
1: 643
2: 1547
3: 1568
4: 1344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048096461 Original CRISPR CTTCCATGTGGTATTAAGCC TGG (reversed) Intergenic
No off target data available for this crispr