ID: 1048098131

View in Genome Browser
Species Human (GRCh38)
Location 8:131316516-131316538
Sequence CAGTATGTACGGGGGTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048098131_1048098136 3 Left 1048098131 8:131316516-131316538 CCTCTTTACCCCCGTACATACTG No data
Right 1048098136 8:131316542-131316564 AGCCTGAACGTTGCATCTTCTGG No data
1048098131_1048098137 4 Left 1048098131 8:131316516-131316538 CCTCTTTACCCCCGTACATACTG No data
Right 1048098137 8:131316543-131316565 GCCTGAACGTTGCATCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048098131 Original CRISPR CAGTATGTACGGGGGTAAAG AGG (reversed) Intergenic
No off target data available for this crispr