ID: 1048099163

View in Genome Browser
Species Human (GRCh38)
Location 8:131329046-131329068
Sequence CAGATAATGCAGTTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048099163_1048099165 20 Left 1048099163 8:131329046-131329068 CCTTGTTCCAACTGCATTATCTG No data
Right 1048099165 8:131329089-131329111 AGACAATTCAGTTAGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048099163 Original CRISPR CAGATAATGCAGTTGGAACA AGG (reversed) Intergenic
No off target data available for this crispr