ID: 1048100252

View in Genome Browser
Species Human (GRCh38)
Location 8:131343186-131343208
Sequence TCCACCCTTCTGGATCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048100252_1048100259 19 Left 1048100252 8:131343186-131343208 CCTGCCGGATCCAGAAGGGTGGA No data
Right 1048100259 8:131343228-131343250 ACAATGGTGATCAGCAGCGGTGG No data
1048100252_1048100258 16 Left 1048100252 8:131343186-131343208 CCTGCCGGATCCAGAAGGGTGGA No data
Right 1048100258 8:131343225-131343247 GTGACAATGGTGATCAGCAGCGG No data
1048100252_1048100260 23 Left 1048100252 8:131343186-131343208 CCTGCCGGATCCAGAAGGGTGGA No data
Right 1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG No data
1048100252_1048100256 -10 Left 1048100252 8:131343186-131343208 CCTGCCGGATCCAGAAGGGTGGA No data
Right 1048100256 8:131343199-131343221 GAAGGGTGGAAGTCAGTGGCAGG No data
1048100252_1048100257 3 Left 1048100252 8:131343186-131343208 CCTGCCGGATCCAGAAGGGTGGA No data
Right 1048100257 8:131343212-131343234 CAGTGGCAGGTCTGTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048100252 Original CRISPR TCCACCCTTCTGGATCCGGC AGG (reversed) Intergenic
No off target data available for this crispr