ID: 1048100260

View in Genome Browser
Species Human (GRCh38)
Location 8:131343232-131343254
Sequence TGGTGATCAGCAGCGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048100250_1048100260 24 Left 1048100250 8:131343185-131343207 CCCTGCCGGATCCAGAAGGGTGG No data
Right 1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG No data
1048100253_1048100260 19 Left 1048100253 8:131343190-131343212 CCGGATCCAGAAGGGTGGAAGTC No data
Right 1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG No data
1048100255_1048100260 13 Left 1048100255 8:131343196-131343218 CCAGAAGGGTGGAAGTCAGTGGC No data
Right 1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG No data
1048100252_1048100260 23 Left 1048100252 8:131343186-131343208 CCTGCCGGATCCAGAAGGGTGGA No data
Right 1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048100260 Original CRISPR TGGTGATCAGCAGCGGTGGA CGG Intergenic
No off target data available for this crispr