ID: 1048109350

View in Genome Browser
Species Human (GRCh38)
Location 8:131450838-131450860
Sequence TGTCTTTTGCAGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048109350_1048109354 16 Left 1048109350 8:131450838-131450860 CCATCCATGTCCTGCAAAAGACA No data
Right 1048109354 8:131450877-131450899 CATGGCTGCATAGTATTTCATGG 0: 32
1: 1218
2: 26388
3: 13826
4: 8090
1048109350_1048109353 -2 Left 1048109350 8:131450838-131450860 CCATCCATGTCCTGCAAAAGACA No data
Right 1048109353 8:131450859-131450881 CATTATCTCATTCTTTTTCATGG 0: 6
1: 161
2: 1808
3: 7010
4: 16281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048109350 Original CRISPR TGTCTTTTGCAGGACATGGA TGG (reversed) Intergenic
No off target data available for this crispr