ID: 1048110729

View in Genome Browser
Species Human (GRCh38)
Location 8:131465377-131465399
Sequence CATTTTGTAGAGATGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048110729_1048110735 2 Left 1048110729 8:131465377-131465399 CCAAACCCCATCTCTACAAAATG No data
Right 1048110735 8:131465402-131465424 CAAAAATTAGCTGGGTATCAAGG 0: 8
1: 324
2: 5495
3: 55693
4: 121390
1048110729_1048110734 -6 Left 1048110729 8:131465377-131465399 CCAAACCCCATCTCTACAAAATG No data
Right 1048110734 8:131465394-131465416 AAAATGTACAAAAATTAGCTGGG No data
1048110729_1048110736 30 Left 1048110729 8:131465377-131465399 CCAAACCCCATCTCTACAAAATG No data
Right 1048110736 8:131465430-131465452 GCTTATAGTCCAAGCTACTCAGG 0: 2
1: 219
2: 8398
3: 102560
4: 229301
1048110729_1048110733 -7 Left 1048110729 8:131465377-131465399 CCAAACCCCATCTCTACAAAATG No data
Right 1048110733 8:131465393-131465415 CAAAATGTACAAAAATTAGCTGG 0: 8
1: 468
2: 9519
3: 109340
4: 101524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048110729 Original CRISPR CATTTTGTAGAGATGGGGTT TGG (reversed) Intergenic
No off target data available for this crispr