ID: 1048115486

View in Genome Browser
Species Human (GRCh38)
Location 8:131517197-131517219
Sequence GAGGGTAAGCAGAAGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048115486_1048115495 25 Left 1048115486 8:131517197-131517219 CCTGCATCCTTCTGCTTACCCTC No data
Right 1048115495 8:131517245-131517267 ACAAATCTGGACTACCTTGGTGG No data
1048115486_1048115494 22 Left 1048115486 8:131517197-131517219 CCTGCATCCTTCTGCTTACCCTC No data
Right 1048115494 8:131517242-131517264 GGAACAAATCTGGACTACCTTGG No data
1048115486_1048115492 1 Left 1048115486 8:131517197-131517219 CCTGCATCCTTCTGCTTACCCTC No data
Right 1048115492 8:131517221-131517243 TGGATCTCTGCTTCAACTATGGG No data
1048115486_1048115493 12 Left 1048115486 8:131517197-131517219 CCTGCATCCTTCTGCTTACCCTC No data
Right 1048115493 8:131517232-131517254 TTCAACTATGGGAACAAATCTGG No data
1048115486_1048115496 28 Left 1048115486 8:131517197-131517219 CCTGCATCCTTCTGCTTACCCTC No data
Right 1048115496 8:131517248-131517270 AATCTGGACTACCTTGGTGGAGG No data
1048115486_1048115491 0 Left 1048115486 8:131517197-131517219 CCTGCATCCTTCTGCTTACCCTC No data
Right 1048115491 8:131517220-131517242 TTGGATCTCTGCTTCAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048115486 Original CRISPR GAGGGTAAGCAGAAGGATGC AGG (reversed) Intergenic
No off target data available for this crispr