ID: 1048117188

View in Genome Browser
Species Human (GRCh38)
Location 8:131537564-131537586
Sequence ACTTAAAAGGAGAAGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048117188_1048117196 18 Left 1048117188 8:131537564-131537586 CCCCCCAGCTTCTCCTTTTAAGT No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048117188 Original CRISPR ACTTAAAAGGAGAAGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr