ID: 1048117196

View in Genome Browser
Species Human (GRCh38)
Location 8:131537605-131537627
Sequence TCCACAACTATTACTACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048117191_1048117196 15 Left 1048117191 8:131537567-131537589 CCCAGCTTCTCCTTTTAAGTGTT No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data
1048117194_1048117196 5 Left 1048117194 8:131537577-131537599 CCTTTTAAGTGTTTTTGGTCAGC No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data
1048117192_1048117196 14 Left 1048117192 8:131537568-131537590 CCAGCTTCTCCTTTTAAGTGTTT No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data
1048117188_1048117196 18 Left 1048117188 8:131537564-131537586 CCCCCCAGCTTCTCCTTTTAAGT No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data
1048117190_1048117196 16 Left 1048117190 8:131537566-131537588 CCCCAGCTTCTCCTTTTAAGTGT No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data
1048117189_1048117196 17 Left 1048117189 8:131537565-131537587 CCCCCAGCTTCTCCTTTTAAGTG No data
Right 1048117196 8:131537605-131537627 TCCACAACTATTACTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048117196 Original CRISPR TCCACAACTATTACTACTTC AGG Intergenic
No off target data available for this crispr