ID: 1048118673

View in Genome Browser
Species Human (GRCh38)
Location 8:131554819-131554841
Sequence AGGGAGAGCACAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048118667_1048118673 14 Left 1048118667 8:131554782-131554804 CCTCCTGGCGTGAAGAATGAATC No data
Right 1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG No data
1048118668_1048118673 11 Left 1048118668 8:131554785-131554807 CCTGGCGTGAAGAATGAATCTGT No data
Right 1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG No data
1048118666_1048118673 25 Left 1048118666 8:131554771-131554793 CCTGGCAGTGGCCTCCTGGCGTG No data
Right 1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048118673 Original CRISPR AGGGAGAGCACAGTGACTGT GGG Intergenic