ID: 1048127679

View in Genome Browser
Species Human (GRCh38)
Location 8:131655542-131655564
Sequence ACATTCTCCAAGCCTACGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048127679_1048127681 22 Left 1048127679 8:131655542-131655564 CCCAACGTAGGCTTGGAGAATGT No data
Right 1048127681 8:131655587-131655609 TAGAAAATAGTCTGAGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048127679 Original CRISPR ACATTCTCCAAGCCTACGTT GGG (reversed) Intergenic
No off target data available for this crispr