ID: 1048138343

View in Genome Browser
Species Human (GRCh38)
Location 8:131768330-131768352
Sequence GAAGCTGGTGCTCCACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048138343_1048138349 19 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138349 8:131768372-131768394 TCAGGTCAAAAATGAGGCAGTGG No data
1048138343_1048138350 26 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138350 8:131768379-131768401 AAAAATGAGGCAGTGGCTCCTGG No data
1048138343_1048138351 27 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138351 8:131768380-131768402 AAAATGAGGCAGTGGCTCCTGGG No data
1048138343_1048138347 1 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138347 8:131768354-131768376 CAATTCATCAGGAGGTTTTCAGG No data
1048138343_1048138348 13 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138348 8:131768366-131768388 AGGTTTTCAGGTCAAAAATGAGG No data
1048138343_1048138346 -7 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138346 8:131768346-131768368 CAGCTTCTCAATTCATCAGGAGG No data
1048138343_1048138344 -10 Left 1048138343 8:131768330-131768352 CCTGCAGGTGGAGCACCAGCTTC No data
Right 1048138344 8:131768343-131768365 CACCAGCTTCTCAATTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048138343 Original CRISPR GAAGCTGGTGCTCCACCTGC AGG (reversed) Intergenic
No off target data available for this crispr